Talk:20.109(S13):Context-setting and primer design (Day1): Difference between revisions
(98 intermediate revisions by 23 users not shown) | |||
Line 1: | Line 1: | ||
==T/R section== | ==Update for everyone== | ||
As explained in pre-lab lecture, we were remiss (mainly me, Agi!) in not providing you with the best sequence information for ''V corneae''. Moreover, we told you to shoot for a Tm of 58 °C instead of a Tm of 63 °C (Ta of 58 °C). | |||
Below, we have listed modified primer sequences (just under your originals) that match the Broad sequence. An ApE file of this sequence is linked [[Media:Vcorneae_SSU-Broad-direct.gb | here]]. For comparison, the complete sequences from [[Media:Vcorneae_SUU-complete-Baker.gb | Baker et al]] and [[Media:Vcorneae_SSU-complete-DaSilva.gb | DaSilva et al.]] are each linked. You can ''Align Sequences'' (under ''Tools'') in ApE to see the differences for yourself. | |||
As a default, we will order these primers on Tuesday for arrival on Thursday, and run two separate PCRs: one at Ta = 58 °C and one at Ta = 53 °C. | |||
However, if you would like to revise your primers to a Tm of 63 °C, we will accept these new designs through Monday at 9 pm. | |||
==T/R section (primer check in progress)== | |||
Please sign up for one of the design challenges -- four teams per challenge -- right away. | Please sign up for one of the design challenges -- four teams per challenge -- right away. | ||
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered. | When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered. | ||
I will name your primers by the approximate base-pair that they target in ''V corneae'' or ''E hellem'', so please share this information as well. | |||
===Sensitivity=== | ===Sensitivity=== | ||
Line 9: | Line 21: | ||
{| border="1" | {| border="1" | ||
|Team color | |Team color | ||
|Forward primer | |Forward (F) primer | ||
|Reverse primer | |Reverse (R) primer | ||
|Target site (e.g. bp 60), F | |||
|Target side (e.g., bp 300), R | |||
|Is bp # for VC or EH? Which gene? | |||
|- | |- | ||
| | | Grey (Platinum) :) | ||
| | | CAT GCT TGC CAA CAC AG<br>Agi: PT so unchanged | ||
| | | GAA TGG TCT GGT TGC TTC<br>Agi: PT so unchanged | ||
| bp 9 | |||
| bp 251 | |||
| E. Hellem: polar tube protein gene | |||
|- | |- | ||
| | |Green | ||
| | |AGG TTG ATT CTG CCT GAC<br>Agi: fine | ||
| | |CGG AAC CAA ACC CTG AT<br>Agi: '''C''' CGG '''T'''AC '''A'''AA ACC CT'''A''' AT<br>new G/C = 44.4%, new Tm = 55.8<br>added 1 extra base to increase Tm | ||
|bp 5 | |||
|bp 236 | |||
|VC: SSU rRNA | |||
|- | |- | ||
| | |Pink | ||
| | |ttctgcctgacgtagatg<br>Agi: fine | ||
| | |cctctccggaaccaaac<br>Agi: CCT CTC CGG '''T'''AC '''A'''AA AC <br>new G/C = 52.9%, new Tm = 55.6 | ||
|bp 12 | |||
|bp 226 | |||
|VC | |||
|- | |- | ||
| | |Yellow | ||
| | |CTGACGTGGATGCTATTC<br>Agi: '''c''' ctg acg t'''a'''g atg cta '''g'''tc<br>new G/C = 50%, new Tm = 56.4 - oops, 55.1<br>added one more "c" at 5' for Tm = 57.7 | ||
| | |CCGTCAACCGTCACTGTC<br>Agi: fine | ||
|bp 18 | |||
|bp 199 | |||
|VC small subunit ribosomal RNA gene | |||
|- | |- | ||
|} | |} | ||
Line 38: | Line 65: | ||
|Forward primer | |Forward primer | ||
|Reverse primer | |Reverse primer | ||
|Target site (e.g. bp 60), F | |||
|Target side (e.g., bp 300), R | |||
|Is bp # for VC or EH? Which gene? | |||
|- | |- | ||
| Purple | | Purple | ||
| | |5' GCG ATG ATT TAG TCT GGC 3'<br>Agi: fine | ||
| | |5’ CAA TTT CCA ACG ACC ATG C 3’<br>Agi: fine | ||
| bp 93, F | |||
| bp 879, R | |||
|VC, SSU rRNA | |||
|- | |- | ||
|Red | |Red | ||
| | |GGT TGA TTC TGC CTG ACG TGG<br>Agi:fine | ||
| | |CCT TCG TCC TTC ATC ACC ACA A<br>Agi: CCT TCG TCC TT'''G''' ATC ACC '''GA'''A '''T''' (yours doesn't match ''any'' known sequence in last 4 bp -- do I have right region?)<br>new G/C = 50%, new Tm = 63.5 | ||
|bp 6, F | |||
|bp 588, R | |||
|VC, SSU RNA | |||
|- | |- | ||
|Orange | |Orange | ||
| | |5'cgt agt cat aga agg gca aag ag3'<br>Agi: fine | ||
| | |5' ctc tct ctc tac ctg cta ttg ta 3'<br>Agi: fine | ||
|441 | |||
|1005 | |||
|V. corneae TV4/TV5 SSU rRNA | |||
|- | |- | ||
|Blue | |Blue | ||
| | |CCGCAATCAGGGACGAA<br>Agi: fine | ||
| | |GTCAACGTCACTGTCTTGG<br>Agi: GTC AAC '''C''' GTC ACT GTC TTG G (insertion) <br>new G/C = 55%, new Tm = 61.8 | ||
|60 | |||
|195 | |||
|V. corneae TV4/TV5 SSU rRNA | |||
|- | |- | ||
|} | |} | ||
Line 64: | Line 106: | ||
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered. | When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered. | ||
I will name your primers by the approximate base-pair that they target in ''V corneae'' or ''E hellem'', so please share this information as well. | |||
===Sensitivity=== | ===Sensitivity=== | ||
Line 69: | Line 113: | ||
{| border="1" | {| border="1" | ||
|Team color | |Team color | ||
|Forward primer | |Forward (F) primer | ||
|Reverse primer | |Reverse (R) primer | ||
|Target site (e.g. bp 60), F | |||
|Target side (e.g., bp 300), R | |||
|Is bp # for VC or EH? Which gene? | |||
|- | |- | ||
| | |Purple | ||
| | |5' GGACGGCTCAGTGATAG 3'<br>Agi:fine for EH | ||
| | |5' CTACCACACCCAGAACTTAC 3'<br>Agi:fine for EH | ||
|bp 84, F | |||
|bp 167, R | |||
|EH, SSU rRNA | |||
|- | |- | ||
| | |Yellow | ||
| | |5' GAGAAGTAAGATGTTTAGCAAGTAT 3'<br>Agi:fine for EH | ||
| | |5' CATCACCACAAAAGTCCAA 3'<br>Agi:fine for EH | ||
|bp 359, F | |||
|bp 630, R | |||
|EH, SSU rRNA | |||
|- | |- | ||
| | |Red | ||
| | |5' CCA GGT TGA TTC TGC CTG 3' <br>Agi:fine | ||
| | |5' CTC TCC GGA ACC AAA CC 3' <br>Agi: CTC TCC GG'''T''' AC'''A''' AAA CC<br>new G/C = 53%, new Tm = 55.6 | ||
| | |bp 9, F | ||
|bp 225, R | |||
| | |VC, SSU, rRNA | ||
| | |||
|- | |- | ||
|Platinum | |||
| 5' CAT GTT GAT TCT GCC TGA C 3'<br>Agi:fine for EH | |||
| 5' CTC TCC TGA ACC AAA CCC TG 3'<br>Agi:fine for EH | |||
| bp 4, F | |||
| bp 278, R | |||
| EH, SSU rRNA | |||
|} | |} | ||
Line 95: | Line 153: | ||
{| border="1" | {| border="1" | ||
|Team | |Team Color | ||
|Forward primer | |Forward primer | ||
|Reverse primer | |Reverse primer | ||
|Target site (e.g. bp 60), F | |||
|Target side (e.g., bp 300), R | |||
|Is bp # for VC or EH? Which gene? | |||
|- | |- | ||
| | | Pink | ||
| | |TTCTGCCTGACGTAGATG<br>Agi: fine | ||
| | |TCAACCGTCACTGTCTTG<br>Agi: fine | ||
|bp 12 | |||
|bp 213 | |||
|for VC TV4 SSU rRNA | |||
|- | |- | ||
| | |Green | ||
| | |AATCAGGGACGAATAGCTC<br>Agi: fine; emailed change: GCAATCAGGGACGAATAGCTCAG | ||
| | |TGATAGTCCTGCGTCTTATTC<br>Agi: fine; emailed change: AACTGATAGTCCTGCGTCTTATTCTG | ||
|bp 64 | |||
|bp 169 | |||
|VC SSU rRNA, full sequence | |||
|- | |- | ||
| | |Orange | ||
| | |CTGCCTGACGTAGATGCTAG<br>Agi: fine | ||
| | |CTGTCTTGGTAGTCCACTAC <br>Agi: CTG TCT TGG TAG TCC '''ATTAC''' AC TAC (5 insertions -- but ''no'' sequence that I found matches yours, most only require 1 insertion -- so check your work please)<br>new G/C = 44%, new Tm = 61.7 | ||
|bp 14 | |||
| | |bp 203 | ||
| | |VC TV4 SSU rRNA gene | ||
| | |||
|- | |- | ||
| Blue | |||
| ACGAGCAATACAGGAGTGG<br>Agi: fine | |||
| TCCATCTGAGCACCTTCC<br>Agi: fine | |||
| bp 841 | |||
| bp 1049 | |||
| VC SSU rRNA | |||
|} | |} | ||
<br style="clear:both;"/> | <br style="clear:both;"/> |
Latest revision as of 09:50, 19 February 2013
Update for everyone
As explained in pre-lab lecture, we were remiss (mainly me, Agi!) in not providing you with the best sequence information for V corneae. Moreover, we told you to shoot for a Tm of 58 °C instead of a Tm of 63 °C (Ta of 58 °C).
Below, we have listed modified primer sequences (just under your originals) that match the Broad sequence. An ApE file of this sequence is linked here. For comparison, the complete sequences from Baker et al and DaSilva et al. are each linked. You can Align Sequences (under Tools) in ApE to see the differences for yourself.
As a default, we will order these primers on Tuesday for arrival on Thursday, and run two separate PCRs: one at Ta = 58 °C and one at Ta = 53 °C.
However, if you would like to revise your primers to a Tm of 63 °C, we will accept these new designs through Monday at 9 pm.
T/R section (primer check in progress)
Please sign up for one of the design challenges -- four teams per challenge -- right away.
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.
I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.
Sensitivity
Team color | Forward (F) primer | Reverse (R) primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
Grey (Platinum) :) | CAT GCT TGC CAA CAC AG Agi: PT so unchanged |
GAA TGG TCT GGT TGC TTC Agi: PT so unchanged |
bp 9 | bp 251 | E. Hellem: polar tube protein gene |
Green | AGG TTG ATT CTG CCT GAC Agi: fine |
CGG AAC CAA ACC CTG AT Agi: C CGG TAC AAA ACC CTA AT new G/C = 44.4%, new Tm = 55.8 added 1 extra base to increase Tm |
bp 5 | bp 236 | VC: SSU rRNA |
Pink | ttctgcctgacgtagatg Agi: fine |
cctctccggaaccaaac Agi: CCT CTC CGG TAC AAA AC new G/C = 52.9%, new Tm = 55.6 |
bp 12 | bp 226 | VC |
Yellow | CTGACGTGGATGCTATTC Agi: c ctg acg tag atg cta gtc new G/C = 50%, new Tm = 56.4 - oops, 55.1 added one more "c" at 5' for Tm = 57.7 |
CCGTCAACCGTCACTGTC Agi: fine |
bp 18 | bp 199 | VC small subunit ribosomal RNA gene |
Specificity
Team Color | Forward primer | Reverse primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
Purple | 5' GCG ATG ATT TAG TCT GGC 3' Agi: fine |
5’ CAA TTT CCA ACG ACC ATG C 3’ Agi: fine |
bp 93, F | bp 879, R | VC, SSU rRNA |
Red | GGT TGA TTC TGC CTG ACG TGG Agi:fine |
CCT TCG TCC TTC ATC ACC ACA A Agi: CCT TCG TCC TTG ATC ACC GAA T (yours doesn't match any known sequence in last 4 bp -- do I have right region?) new G/C = 50%, new Tm = 63.5 |
bp 6, F | bp 588, R | VC, SSU RNA |
Orange | 5'cgt agt cat aga agg gca aag ag3' Agi: fine |
5' ctc tct ctc tac ctg cta ttg ta 3' Agi: fine |
441 | 1005 | V. corneae TV4/TV5 SSU rRNA |
Blue | CCGCAATCAGGGACGAA Agi: fine |
GTCAACGTCACTGTCTTGG Agi: GTC AAC C GTC ACT GTC TTG G (insertion) new G/C = 55%, new Tm = 61.8 |
60 | 195 | V. corneae TV4/TV5 SSU rRNA |
W/F section
Please sign up for one of the design challenges -- four teams per challenge -- right away.
When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.
I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.
Sensitivity
Team color | Forward (F) primer | Reverse (R) primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
Purple | 5' GGACGGCTCAGTGATAG 3' Agi:fine for EH |
5' CTACCACACCCAGAACTTAC 3' Agi:fine for EH |
bp 84, F | bp 167, R | EH, SSU rRNA |
Yellow | 5' GAGAAGTAAGATGTTTAGCAAGTAT 3' Agi:fine for EH |
5' CATCACCACAAAAGTCCAA 3' Agi:fine for EH |
bp 359, F | bp 630, R | EH, SSU rRNA |
Red | 5' CCA GGT TGA TTC TGC CTG 3' Agi:fine |
5' CTC TCC GGA ACC AAA CC 3' Agi: CTC TCC GGT ACA AAA CC new G/C = 53%, new Tm = 55.6 |
bp 9, F | bp 225, R | VC, SSU, rRNA |
Platinum | 5' CAT GTT GAT TCT GCC TGA C 3' Agi:fine for EH |
5' CTC TCC TGA ACC AAA CCC TG 3' Agi:fine for EH |
bp 4, F | bp 278, R | EH, SSU rRNA |
Specificity
Team Color | Forward primer | Reverse primer | Target site (e.g. bp 60), F | Target side (e.g., bp 300), R | Is bp # for VC or EH? Which gene? |
Pink | TTCTGCCTGACGTAGATG Agi: fine |
TCAACCGTCACTGTCTTG Agi: fine |
bp 12 | bp 213 | for VC TV4 SSU rRNA |
Green | AATCAGGGACGAATAGCTC Agi: fine; emailed change: GCAATCAGGGACGAATAGCTCAG |
TGATAGTCCTGCGTCTTATTC Agi: fine; emailed change: AACTGATAGTCCTGCGTCTTATTCTG |
bp 64 | bp 169 | VC SSU rRNA, full sequence |
Orange | CTGCCTGACGTAGATGCTAG Agi: fine |
CTGTCTTGGTAGTCCACTAC Agi: CTG TCT TGG TAG TCC ATTAC AC TAC (5 insertions -- but no sequence that I found matches yours, most only require 1 insertion -- so check your work please) new G/C = 44%, new Tm = 61.7 |
bp 14 | bp 203 | VC TV4 SSU rRNA gene |
Blue | ACGAGCAATACAGGAGTGG Agi: fine |
TCCATCTGAGCACCTTCC Agi: fine |
bp 841 | bp 1049 | VC SSU rRNA |