Talk:20.109(S11):Complete DNA design (Day2): Difference between revisions
No edit summary |
No edit summary |
||
Line 80: | Line 80: | ||
|Blue | |Blue | ||
|5'CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGCACATTTTACCTCTGGCGGTGATAG3’<br> | |5'CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGCACATTTTACCTCTGGCGGTGATAG3’<br> | ||
5'GATCCTATCACCGCCAGAGGTAAAATGTGCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC3 | |||
|We chose to mutate the -35 region of P(R) that doesn't have an overlap with the OR2 region, since we think the -35 region of P(R) isn't necessary for transcription of P(lux-lambda). Hopefully this will reduce the basal expression of P(lux-lambda). We switched 3 base pairs (ACT) to (CAC) based on looking at the consensus sequence and modifying it to look as different as possible. | |We chose to mutate the -35 region of P(R) that doesn't have an overlap with the OR2 region, since we think the -35 region of P(R) isn't necessary for transcription of P(lux-lambda). Hopefully this will reduce the basal expression of P(lux-lambda). We switched 3 base pairs (ACT) to (CAC) based on looking at the consensus sequence and modifying it to look as different as possible. | ||
| | | |
Revision as of 13:05, 11 March 2011
High-level designs and implementation with primers
T/R
Group | Forward primer; <br>Reverse primer | Summary of approach | ||
---|---|---|---|---|
Blue | 5’CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGTTTTACCTCTGGCGGTGATAGGG3’ 5’GATCCCCTATCACCGCCAGAGGTAAAACAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC3’ |
The Plux-lamda promoter may be leaky due to the high basal expression of the Pr promoter. We are deleting part of the -35 region (after Or2) in the Pr promoter and adding 2 G's in the middle of -10 region (right after Or1) in order to reduce the strength of the promoter and decrease the AT richness in the sequence. | ||
Pink | 5'CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATACCTCTGGCGGTGATATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAGGATCC3' 5'AAATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATATCACCGCCAGAGGTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG 3' |
We are inserting a second copy of the Or1 sequence directly infront of Or2 to hopefully improve repressing of the operons | ||
Green | 5’CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCCCCTAACACCGTGCGTGTTGCCCCTTTTACCTCTGGCGGTGATACCGGATCC3’ 3'GGGCCCATTCGTGGACATCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGGGGATTGTGGCACGCACAACGGGGAAAATGGAGACCGCCACTATGGCCTAGG5' |
We are substituting all -10 and -35 regions in the Or1 and Or2 regions to C's. This way, frameshift mutations can be prevented. They also avoid the restrict enzyme interference. | ||
Yellow | 5' CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTTGCTATTTTTACCTCTGGCGGTGATATTGGATCC 3'
5’GGATCCAATATCACCGCCAGAGGTAAAAATAGCAAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG 3’ |
We decided to change 2 nucleotides in the -35 region of P(R), and 1 nucleotide in the -10 region. We also added an extra basepair to between these two regions, increasing its length. These changes make the promoter less ideal of a binding site, therefore making it a weaker promoter. We chose the changes in nucleotides based on the lac promoter consensus sequence. | ||
Red | 5'CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGGGTGGCACCGTGCGTGGCACTGGTTTTACCTCTGGCGGTGATAG3'
5'GATCCTATCACCGCCAGAGGTAAAACCAGCGACACGCACGGTGCCACCCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC3' |
We decided to drastically mutate the -10 and -35 sequences located inside of the Or2 operator in hopes of weakening the promoter without significantly weakening the repressor binding. We made these sequences g and c rich since they are usually t and a rich. | ||
Purple | 5’CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTAGGGTACCTCTGGCGGTGATAGGATCC3’ 5'GGATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG3’ |
We are substituting the TTT base pair sequence between OR1 and OR2 regions to GGG. This way, we can avoid changing the OR1 and OR2 while changing the promoter region and possibly reducing its activation level. Because bacteria promoters are often rich in A's and T's, we chose to change the TTT to GGG. | ||
Orange | updated sequences:
sense strand: 5’-CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGTTGGGATCC – 3’ complement: 3’-GGGCCCATTCGTGGACATCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGCTTATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACAACCCTAGG – 5’ |
design rationale:
to reduce the strength of the promoter, we decided that the best candidate regions to alter would be the -35 and -10 upstream regulatory regions. Since altering more than 1 region at a time could have confusing effects (i.e. it gets harder to detect which change caused what effect), we decided to finally just change the -10 region, as it would have a more pronounced effect (since it is closer to the promoter). The -10 region has bases GATA. We wanted to replace these 4 bases, and also ensure that our new sequence was not similar to the consensus sequences. We were also curious to know what might happen if we used the last 4 bases of the OR2 region instead of these 4 bases, since these 4 happen to be the last 4 bases of the OR1 region. Thus, we ended up replacing the GATA by GTTG. |
W/F
Group | Forward primer; <br>Reverse primer | Summary of approach | |
---|---|---|---|
Yellow | 5’CCGGGTAAGCACCTGTGGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGTTGG3’
3’CATTCGTGGACACCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGCTTATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACAACCCTAG5’ |
We chose to modify both the lambda -10 region and the lux box of the hybrid promoter. We modified our -10 region the same as TR Orange (GATA –> GTTG) to reduce the basal expression level. We determined from a primary source that modification of A7 to guanine yields ~25% reduction in promoter activity. Anticipating the reduced ability of cI protein product to repress in the aforemention -10 region, we are also reducing the activity of the lux box as compensation. | |
Purple | 5’CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGCTGACGTTTTACCTCTGGCGGTGATAGTCCTAG3’
3’GGCCCATTCGTGGACATCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGCTTATTGTGGCACGCACGACTGCAAAATGGAGACCGCCACTATCAGGATC5’ |
In order to decrease the strength of the promoter and stop leaky expression of lacZ, we wanted to decrease the binding affinity that RNA polymerase had for the -10 and -35 regions of the lambda promoter. We found the araBAD promoter, which is a weak promoter for RNAP, so we completely changed the -35 region to match araBAD and changed only the last two base pairs of the -10 region to match araBAD. We didn’t want to change the “GATA” of the -10 region in the OR1 because we didn’t want to affect repression by c1 (OR1 is more important to c1 repression than OR2). | |
Green | 5’ – CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGCGCATG– 3’ 5’ – GATCCATGCGCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC – 3’ |
We found online that the -10 region is necessary for transcription, but the -35 region just increases the amount of transcription. We didn’t want to change these regions in the PluxI part of the promoter, because we want transcription of the downstream sequence to be high when the AHL-LuxR complex binds to PluxI to activate transcription. However, we don’t want lacZ to be transcribed unless the repressor is absent. In the current system, since we have the essential -10 region, it is still possible for transcription of lacZ to occur in the absence of activator, so long as the repressor is not present, especially since PR does not require an activator, as stated on the Module 2 Day 2 wiki. So, if we mutate the -10 region of PR such that it can no longer activate transcription, the only way that the lacZ gene can be expressed is if the AHL-LuxR complex is present to initiate transcription from the PluxI -10 region. Since binding of the repressor at OR2 increases the binding of the repressor at OR1 by 10 fold, again as stated on the Module 2 Day 2 wiki, we hope that changing the portion of the -10 region that overlaps with OR1 will not significantly affect the binding of the repressor. | |
Blue | 5'CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGCACATTTTACCTCTGGCGGTGATAG3’ 5'GATCCTATCACCGCCAGAGGTAAAATGTGCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC3 |
We chose to mutate the -35 region of P(R) that doesn't have an overlap with the OR2 region, since we think the -35 region of P(R) isn't necessary for transcription of P(lux-lambda). Hopefully this will reduce the basal expression of P(lux-lambda). We switched 3 base pairs (ACT) to (CAC) based on looking at the consensus sequence and modifying it to look as different as possible. | |