Synthetic Biology:Vectors/Parts: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(27 intermediate revisions by 2 users not shown)
Line 2: Line 2:


Some have just been designed while others have been constructed and tested.  See the associated registry page for details.
Some have just been designed while others have been constructed and tested.  See the associated registry page for details.
To construct BioBrick vectors, use the BioBrick base vector <bbpart>BBa_I51020</bbpart>.  See [http://parts.mit.edu/registry/index.php/Help:Plasmids/Construction how to construct a BioBrick vector]


==Replication origins==
==Replication origins==
Line 7: Line 9:
*<bbpart>BBa_I50001</bbpart>: F plasmid backbone with BioBricks restriction sites removed, reverse orientation.
*<bbpart>BBa_I50001</bbpart>: F plasmid backbone with BioBricks restriction sites removed, reverse orientation.
*<bbpart>BBa_I50010</bbpart>: oriV origin which requires TrfA protein to be functional.
*<bbpart>BBa_I50010</bbpart>: oriV origin which requires TrfA protein to be functional.
*<bbpart>BBa_I50020</bbpart>: high copy origin of replication from pSB1A3
*<bbpart>BBa_I50022</bbpart>: high copy origin of replication based on pUC19
*<bbpart>BBa_I50030</bbpart>: a pBR322 origin.
*<bbpart>BBa_I50030</bbpart>: a pBR322 origin.
*<bbpart>BBa_I50040</bbpart>: a near minimal pSC101 origin.
*<bbpart>BBa_I50032</bbpart>: a p15A origin.
*<bbpart>BBa_I50041</bbpart>: a near minimal pSC101 origin, reverse orientation.
*<bbpart>BBa_I50042</bbpart>: a pSC101 origin.
*<bbpart>BBa_I50050</bbpart>: a R6K gamma origin. See also [http://www.epibio.com/sequences/R6Kori_Kan2.asp EZ-Tn5™ <R6Kγori /KAN-2> Sequence] [http://www.frankwu.com/R6K.html general information]  (Note: this origin will only replicate in a ''pir<sup>+</sup>'' strain.)
*<bbpart>BBa_I50050</bbpart>: a R6K gamma origin. See also [http://www.epibio.com/sequences/R6Kori_Kan2.asp EZ-Tn5™ <R6Kγori /KAN-2> Sequence] [http://www.frankwu.com/R6K.html general information]  (Note: this origin will only replicate in a ''pir<sup>+</sup>'' strain.)


==Antibiotic resistance cassettes==
==Antibiotic resistance cassettes==
*<bbpart>BBa_P1001</bbpart>: cassette providing tetracycline resistance.
*<bbpart>BBa_P1000</bbpart>: cassette providing chloramphenicol resistance.
*<bbpart>BBa_P1002</bbpart>: cassette providing ampicillin resistance.
*<bbpart>BBa_P1002</bbpart>: cassette providing ampicillin resistance.
*<bbpart>BBa_P1003</bbpart>: cassette providing kanamycin resistance.
*<bbpart>BBa_P1003</bbpart>: cassette providing kanamycin resistance.
*<bbpart>BBa_P1004</bbpart>: cassette providing ampicillin resistance in reverse orientation.
*<bbpart>BBa_P1004</bbpart>: cassette providing chloramphenicol resistance.
*<bbpart>BBa_P1005</bbpart>: cassette providing tetracycline resistance and ampicillin resistance with terminators.
*<bbpart>BBa_P1005</bbpart>: cassette providing tetracycline resistance.
*<bbpart>BBa_P1006</bbpart>: cassette providing chloramphenicol resistance and ampicillin resistance with terminators.
*<bbpart>BBa_P1007</bbpart>: cassette providing kanamycin resistance and ampicillin resistance with terminators.


==Terminators==
==Terminators==
Line 39: Line 37:
==Others==
==Others==
*<bbpart>BBa_P1010</bbpart>: ccd operon in BioBricks format
*<bbpart>BBa_P1010</bbpart>: ccd operon in BioBricks format
*<bbpart> BBa_P1011</bbpart>: ccdB cassette in BioBricks format (ccdA- has been removed)
*<bbpart> BBa_P1016</bbpart>: ccdB cassette in BioBricks format (ccdA- has been removed)
*<bbpart>BBa_B0042</bbpart>: translational stop sequence which provides a stop codon in all six frames (see [[Non-functional DNA sequences]])
*<bbpart>BBa_B0042</bbpart>: translational stop sequence which provides a stop codon in all six frames (see [[Non-functional DNA sequences]])
*<bbpart>BBa_B0043</bbpart>: forward Topoisomerase I cloning site (see [[Topoisomerase I mediated TA cloning]])
*<bbpart>BBa_B0043</bbpart>: forward Topoisomerase I cloning site (see [[Topoisomerase I mediated TA cloning]])
Line 47: Line 45:
*<bbpart>BBa_B0045</bbpart>: antibiotic cassette insertion site (see [[Synthetic Biology:Vectors/Modular construction scheme]])
*<bbpart>BBa_B0045</bbpart>: antibiotic cassette insertion site (see [[Synthetic Biology:Vectors/Modular construction scheme]])
*<bbpart>BBa_B0046</bbpart>: replication origin insertion site (see [[Synthetic Biology:Vectors/Modular construction scheme]])
*<bbpart>BBa_B0046</bbpart>: replication origin insertion site (see [[Synthetic Biology:Vectors/Modular construction scheme]])
*unique identifier for the vector


==Minimal vector scaffold==
==Removal of restriction sites==
<b>
Given that the current plan is to synthesize the vectors, we can remove restriction sites, mostly at will from the vectors.  What restriction sites should be removed?
5' <''counter-selectable marker''> -- <''high copy origin''> -- BBa_G00001 (BBsuffix) -- BBa_B0044 (TOPO site) -- BBa_B0042 (translational stop sequence) -- <[[Synthetic Biology:Vectors/Barcode |''plasmid barcode'']]> -- BBa_B0054 (terminator) -- BBa_G00102 (VR) -- BBa_B0045 (antibiotic resistance insertion site) -- BBa_B0046 (origin insertion site) -- BBa_G00100 (VF2) -- BBa_B0055 (terminator) -- <[[Synthetic Biology:Vectors/Barcode |''plasmid barcode'']]> -- BBa_B0042 (translational stop sequence) -- BBa_B0043 (TOPO site) -- BBa_G00000 (BB prefix) 3'
</b>


==Ordering information==
===BioBrick enzymes sites===
[[EcoRI]], [[SpeI]], [[XbaI]], [[PstI]], [[NotI]]


===Independently synthesized components===
===Enzymes sites that generate compatible cohesive ends to BioBrick sites===
(This information is for DNA synthesis companies).
*[http://www.neb.com/nebecomm/EnzymeFinderSearchByEnd.asp?txtSequence=AATT&selDirection=2&radSearchType=0 '''EcoRI''']:  [http://www.neb.com/nebecomm/products/productR0566.asp ApoI], [http://www.neb.com/nebecomm/products/productR0589.asp Mfe I]
*[http://www.neb.com/nebecomm/EnzymeFinderSearchByEnd.asp?txtSequence=CTAG&selDirection=2&radSearchType=0 '''SpeI/XbaI''']:  [http://www.neb.com/nebecomm/products/productR0174.asp AvrII], [http://www.neb.com/nebecomm/products/productR0131.asp NheI]
*[http://www.neb.com/nebecomm/EnzymeFinderSearchByEnd.asp?txtSequence=TGCA&selDirection=1&radSearchType=0 '''PstI''']:  [http://www.neb.com/nebecomm/products/productR0127.asp NsiI], [http://www.neb.com/nebecomm/products/productR0642.asp SbfI]


====Vector scaffold====
===Offset cutters===
><bbpart>BBa_I51000</bbpart>  Minimal vector scaffold Length: 408 Base Pairs Including Part and Barcode
[http://www.fermentas.com/catalog/re/aari.htm AarI], [http://www.neb.com/nebecomm/products/productR0580.asp BsmBI], [http://www.neb.com/nebecomm/products/productR0535.asp BsaI], [http://www.neb.com/nebecomm/products/productR0539.asp BbsI], [http://www.neb.com/nebecomm/products/productR0502.asp BspMI], [http://www.neb.com/nebecomm/products/productR0703.asp BtgZI],
Circular
[http://www.neb.com/nebecomm/products/productR0528.asp EarI],


This sequence is the vector scaffold. Into this sequence there are different inserts we'd like to put in at 3 separate locations (the antibiotic resistance marker, the replication origin and the insert). I've listed the optional inserts for each location below. If we get the vector scaffold synthesized without an insert at a particular location then the bases TACTAGAG should be the placeholder sequence at that location.
* [http://www.neb.com/nebecomm/products/productR0641.asp AcuI] (medium priority)
* [http://www.neb.com/nebecomm/products/productR0596.asp BciVI] (would be nice, medium priority)
* [http://www.neb.com/nebecomm/products/productR0701.asp BfuAI] (high priority)
* [http://www.neb.com/nebecomm/products/productR0600.asp BmrI] (high priority)
* [http://www.neb.com/nebecomm/products/productR0559.asp BsgI] (medium priority)
* [http://www.neb.com/nebecomm/products/productR0134.asp BsmI] (includes nicking enzyme, high priority)
* [http://www.neb.com/nebecomm/products/productR0574.asp BsrDI] (includes nicking enzyme, high priority)
* [http://www.neb.com/nebecomm/products/productR0109.asp FokI] (best effort)
* [http://www.neb.com/nebecomm/products/productR0569.asp SapI] (high priority, should already be eliminated from EarI)
* [http://www.neb.com/nebecomm/products/productR0582.asp TspRI] (probably difficult, best effort)
* [http://www.neb.com/nebecomm/products/productR0646.asp EcoP15I] (high priority)


tactagtagcggccgctgcagtactagaggagtcactaagggtactagagttagttagttagtactagagattagcagaa
===Consensus for all known homing endonucleases===
agtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattgggtactagaggctcactcaaagg
These are easy to do so are high priority for elimination.
cggtaattactagaggctagc<tactagag OR antibiotic resistance marker>atgcattactagagcaattg
* [http://www.neb.com/nebecomm/products/category1.asp?#3 NEB]: I-CeuI, I-SceI, PI-PspI, PI-SceI 
<tactagag OR replication origin> cctaggtactagagtgccacctgac
* Also I-PpoI (TAACTATGACTCTCTTAAGGTAGCCAAAT)
gtctaagaatactagagaaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgag
ttgattgctacgtaatactagagttagttagttagtactagagcccttagtgactctactagaggaattcgcggccgctt
ctagag<tactagag or insert>


====Antibiotic resistance marker====
===Would like to be removed===
We want four different resistance markers.  For these parts, in addition to getting them inserted into the vector at the location specified above, we'd also want them as linear pieces in BioBricks format.  The sequence of these pieces will likely change in the event we get them synthesized but the length should stay pretty much the same.  We have some flexibility in the exact sequence of these pieces so if by including or excluding some restriction sites, it becomes cheaper/easier for you to clone, we might be able to do that.  For all of our variants we will want to include both one of BBa_P1000/BBa_P1001/BBa_P1003 and BBa_P1008 in the antibiotic insertion site.


><bbpart>BBa_P1000</bbpart>  CmR Length: 789 Base Pairs Including Part and Barcode
* [http://www.neb.com/nebecomm/products/productR0552.asp AgeI]
* [http://www.neb.com/nebecomm/products/productR0501.asp RsrII]
* [http://www.neb.com/nebecomm/products/productR0603.asp SgrAI]
* [http://www.neb.com/nebecomm/products/productR0194.asp XmnI]
* [http://www.neb.com/nebecomm/products/productR0533.asp XcmI]
* AscI
* FseI


><bbpart>BBa_P1001</bbpart>  TetR Length: 1279 Base Pairs Including Part and Barcode
===Nicking enzymes===
[http://www.neb.com/nebecomm/products/productR0607.asp Nt.BstNBI], BbvCI


><bbpart>BBa_P1003</bbpart>    KanR  Length: 993 Base Pairs Including Part and Barcode
*[http://www.neb.com/nebecomm/products/productR0627.asp Nt.AlwI] (best effort to at least remove sites near each other)


><bbpart>BBa_P1008</bbpart>  Terminator.AmpR.Terminator Length: 1070 Base Pairs Including Part and Barcode
===Other common enzymes===
'''Arbitrary list, feel free to add more.'''


====Replication origin====
HindIII, BamHI, XhoI, NcoI, SacI, NdeI,
We want two different replication origins.  For these parts, in addition to getting them inserted into the vector at the location specified above, we'd also want them as linear pieces in BioBricks format.  The sequence of these pieces will likely change in the event we get them synthesized but the length should stay pretty much the same.  We have some flexibility in the exact sequence of these pieces so if by including or excluding some restriction sites, it becomes cheaper/easier for you to clone, we might be able to do that.


><bbpart>BBa_I50001</bbpart>  F plasmid backbone with BioBrick sites removed, reverse Length: 4640 Base Pairs Including Part and Barcode
'''Additional''' (low priority)
* KasI
* MssI
* NgoMIV
* PacI
* PmeI
* SalI
* SfiI
* SgfI
* SmiI
* SrfI
* SwaI
* XmaI
* ZraI


><bbpart>BBa_I50041</bbpart>  pSC101 origin of replication, reverse Length: 2215 Base Pairs Including Part and Barcode
Would be simplest to destroy all 6 bp palindromic sequences. This destroys a lot of the common 'normal' restriction sites.
*Is there a tool that does this?  [http://slam.bs.jhmi.edu/gd/ GeneDesign] removes sites and optimizes the resulting codons for a particular species.  But it requires that you select which enzymes you want to remove from their list.
* Don't know off the top of my head but you should ask Sri or Leon if there's a tool. They did that for their plasmid for the T7.1 rebuild so they could use more restriction enzymes. GeneDesign appears to actually list the enzyme sites that are in the sequence so assuming it has a good database of enzymes, the question is whether just removing everything it knows about is good enough. I could pretty easily write a program to find all 6 bp palidromes but fixing it with silent mutations would take more work.


====Insert====
===GATC===
There is only one option for the insert.  I only include it separately because depending on cost, we may or may not get it synthesized. The sequence of these pieces will likely change in the event we get them synthesized but the length should stay pretty much the same. We have some flexibility in the exact sequence of these pieces so if by including or excluding some restriction sites, it becomes cheaper/easier for you to clone, we might be able to do that. Note that this sequence encodes ccdB, a toxic gene to E. coli, and therefore will only propagate in special strains which have a mutation that confers resistance to ccdB (i.e. DB3.1)
Another idea I had was whether we want to remove all GATC (DpnI) sites from the plasmid. There are potential benefits and drawbacks to this. One potential downside is that some mutation protocols assume that you can chew up the plasmid by adding DpnI. However if our plasmid had no GATC, we could perhaps use this to our advantage in some way. For example, adding DpnI to cut up only the genomic DNA and not our plasmid (of course, this would only likely work with the base plasmids).


><bbpart>BBa_I52000</bbpart>  ccd with high copy origin Length: 1320 Base Pairs Including Part and Barcode
*'''[[User:Rshetty|RS]] 11:55, 15 May 2006 (EDT)''': Tom actually requested that I specifically include GATC sites in the plasmid to ensure that digestion by DpnI works well.  For cloning purposes, I think that treatment of the destination plasmid digestion with antarctic phosphatase is generally sufficient for reducing the likelihood of cloning genomic DNA.  So I would favor that approach over removing DpnI sites (given that the presence of DpnI sites is useful for site-directed mutagenesis).


====Intact vector====
GATC sites were included as per Drew's request.
In total, there are 3 antibiotic resistance choices * 2 replication origins = 6 total intact vector combinations.


This is one out of the six possible intact vectors that we would like to get synthesized.  It has the insert, both BBa_P1000 and BBa_P1008 as the antibiotic resistance markers and BBa_I50001 origin in the appropriate locations.  We would want this returned as circular DNA.
==Codon frequency==
Rare codons were removed from the antibiotic resistance markers and ccdB.


><bbpart>pSB5AC4</bbpart>  pSB5AC4 Length: 8257 Base Pairs Including Part and Barcode
==Ordering information==


===Individual vector BioBrick parts===
*[[Synthetic Biology:Vectors/Parts/Synthesis order]]
{| border="1"
|-
| '''Part number'''
| '''Description'''
| '''Size'''
| '''BioBrick available'''
| '''Template available'''
| '''Want synthesized as an individual part'''
|-
| colspan="6" | '''BASIC PARTS'''
|--
| BBa_P1010
| ccd
| 675bp
| Yes
| Yes
| No
|--
| BBa_P1011
| ccdB
| 454bp
| No
| No
| Yes
|--| colspan="6" |
|--
|
| BB suffix
| 21bp
| No
| No
| No (can make with primers)
|--
| BBa_B0044
| TOPO site
| 13bp
| No
| No
| No (can make with primers)
|--
| BBa_B0042
| translational stop sequence
| 12bp
| No
| No
| No (can make with primers)
|--
|
| [[Synthetic Biology:Vectors/Barcode | plasmid barcode]]
|
|
|
|
|--
| BBa_B0054
| terminator
| 69bp
| No
| No
| Maybe (can be hard to make terminators with primer extension)
|--
| BBa_G00102
| VR
| 20bp
| No
| No
| No (can make with primers)
|--
| colspan="6" |
|--
| BBa_I50000
| F plasmid origin
| 4640bp
| No
| No
| No
|--
| BBa_I50001
| F plasmid origin, reverse orientation
| 4640bp
| No
| No
| Yes (has 4 BioBricks sites throughout the gene)
|--
| BBa_I50020
| high copy origin (pUC19)
| 858bp
| No
| Yes
| Maybe
|--
| BBa_I50040
| low copy origin (pSC101)
| 2215bp
| No
| Yes
| No
|--
| BBa_I50041
| low copy origin (pSC101)
| 2215bp
| No
| Yes
| Maybe (redundant with BBa_I50030, have template)
|--
| BBa_I50030
| low copy origin (pBR322)
| 2016bp
| No
| Yes
| Maybe (redundant with BBa_I50040)
|--
| colspan="6" |
|--
| BBa_P1000
| CmR
| 789bp
| Yes (Austin)
| Yes
| No
|--
| BBa_P1001
| TetR
| 1279bp
| Yes (Austin)
| Yes
| No
|--
| BBa_P1003
| KanR
| 993bp
| Maybe (TK)
| Yes
| Maybe
|--
| BBa_B0053
| His terminator
| 72bp
| No
| No
| Yes (previous synthesis attempt via primer extension failed)
|--
| BBa_B0062
| reverse rrnC terminator
| 41bp
| No
| No
| Maybe (can be hard to make terminators with primer extension)
|--
| BBa_P1004
| reverse AmpR
| 941bp
| No
| Yes
| Maybe
|--
| BBa_G00100
| VF2
| 20bp
| No
| No
| No (can make with primers)
|--
| BBa_B0055
| terminator
| 78bp
| No
| No
| Maybe (can be hard to make terminators with primer extension)
|--
|
| [[Synthetic Biology:Vectors/Barcode | plasmid barcode]]  
|
|
|
|
|--
| BBa_B0042
| translational stop sequence
| 12bp
| No
| No
| No (can make with primers)
|--
| BBa_B0043
| forward TOPO site
| 13p
| No
| No
| No (can make with primers)
|--
|
| BB prefix
| 22bp
| No
| No
| No (can make with primers)
|--
| colspan="6" | '''COMPOSITE PARTS'''
|--
| BBa_P1005
| tetR and ampR
| 1867bp
| No
| No
| Maybe
|--
| BBa_P1006
| cmR and ampR
| 2357bp
| No
| No
| Maybe
|--
| BBa_P1007
| kanR and ampR
| 2071bp
| No
| No
| Maybe
|}

Latest revision as of 13:25, 25 January 2008

This is a list of BioBricks parts for use in construction of modular vectors.

Some have just been designed while others have been constructed and tested. See the associated registry page for details.

To construct BioBrick vectors, use the BioBrick base vector <bbpart>BBa_I51020</bbpart>. See how to construct a BioBrick vector

Replication origins

  • <bbpart>BBa_I50000</bbpart>: F plasmid backbone with BioBricks restriction sites removed.
  • <bbpart>BBa_I50001</bbpart>: F plasmid backbone with BioBricks restriction sites removed, reverse orientation.
  • <bbpart>BBa_I50010</bbpart>: oriV origin which requires TrfA protein to be functional.
  • <bbpart>BBa_I50022</bbpart>: high copy origin of replication based on pUC19
  • <bbpart>BBa_I50030</bbpart>: a pBR322 origin.
  • <bbpart>BBa_I50032</bbpart>: a p15A origin.
  • <bbpart>BBa_I50042</bbpart>: a pSC101 origin.
  • <bbpart>BBa_I50050</bbpart>: a R6K gamma origin. See also EZ-Tn5™ <R6Kγori /KAN-2> Sequence general information (Note: this origin will only replicate in a pir+ strain.)

Antibiotic resistance cassettes

  • <bbpart>BBa_P1002</bbpart>: cassette providing ampicillin resistance.
  • <bbpart>BBa_P1003</bbpart>: cassette providing kanamycin resistance.
  • <bbpart>BBa_P1004</bbpart>: cassette providing chloramphenicol resistance.
  • <bbpart>BBa_P1005</bbpart>: cassette providing tetracycline resistance.

Terminators

  • <bbpart>BBa_B0055</bbpart>: upstream flanking terminator
  • <bbpart>BBa_B0054</bbpart>: downstream flanking terminator
  • <bbpart>BBa_B0053</bbpart>: bidirectional terminator from E. coli his operon
  • <bbpart>BBa_B0052</bbpart>: forward terminator
  • <bbpart>BBa_B0062</bbpart>: reverse terminator of BBa_B0052.

Notes

It wasn't clear from the website if these were bi-directional? Not sure that this is very important--BC

I don't know if the terminators are bidirectional. These terminators are used as flanking terminators in other vectors and are claimed to make the cloning of difficult pieces of DNA (like strong promoters) easier. This is why I was planning on orienting the antibiotic resistance cassette in the opposite direction so that read through from upstream of the multiple cloning site is less of an issue. -- RS

Primer binding sites

  • <bbpart>BBa_G00100</bbpart>: VF2
  • <bbpart>BBa_G00102</bbpart>: VR

Others

Removal of restriction sites

Given that the current plan is to synthesize the vectors, we can remove restriction sites, mostly at will from the vectors. What restriction sites should be removed?

BioBrick enzymes sites

EcoRI, SpeI, XbaI, PstI, NotI

Enzymes sites that generate compatible cohesive ends to BioBrick sites

Offset cutters

AarI, BsmBI, BsaI, BbsI, BspMI, BtgZI, EarI,

  • AcuI (medium priority)
  • BciVI (would be nice, medium priority)
  • BfuAI (high priority)
  • BmrI (high priority)
  • BsgI (medium priority)
  • BsmI (includes nicking enzyme, high priority)
  • BsrDI (includes nicking enzyme, high priority)
  • FokI (best effort)
  • SapI (high priority, should already be eliminated from EarI)
  • TspRI (probably difficult, best effort)
  • EcoP15I (high priority)

Consensus for all known homing endonucleases

These are easy to do so are high priority for elimination.

  • NEB: I-CeuI, I-SceI, PI-PspI, PI-SceI
  • Also I-PpoI (TAACTATGACTCTCTTAAGGTAGCCAAAT)

Would like to be removed

Nicking enzymes

Nt.BstNBI, BbvCI

  • Nt.AlwI (best effort to at least remove sites near each other)

Other common enzymes

Arbitrary list, feel free to add more.

HindIII, BamHI, XhoI, NcoI, SacI, NdeI,

Additional (low priority)

  • KasI
  • MssI
  • NgoMIV
  • PacI
  • PmeI
  • SalI
  • SfiI
  • SgfI
  • SmiI
  • SrfI
  • SwaI
  • XmaI
  • ZraI

Would be simplest to destroy all 6 bp palindromic sequences. This destroys a lot of the common 'normal' restriction sites.

  • Is there a tool that does this? GeneDesign removes sites and optimizes the resulting codons for a particular species. But it requires that you select which enzymes you want to remove from their list.
  • Don't know off the top of my head but you should ask Sri or Leon if there's a tool. They did that for their plasmid for the T7.1 rebuild so they could use more restriction enzymes. GeneDesign appears to actually list the enzyme sites that are in the sequence so assuming it has a good database of enzymes, the question is whether just removing everything it knows about is good enough. I could pretty easily write a program to find all 6 bp palidromes but fixing it with silent mutations would take more work.

GATC

Another idea I had was whether we want to remove all GATC (DpnI) sites from the plasmid. There are potential benefits and drawbacks to this. One potential downside is that some mutation protocols assume that you can chew up the plasmid by adding DpnI. However if our plasmid had no GATC, we could perhaps use this to our advantage in some way. For example, adding DpnI to cut up only the genomic DNA and not our plasmid (of course, this would only likely work with the base plasmids).

  • RS 11:55, 15 May 2006 (EDT): Tom actually requested that I specifically include GATC sites in the plasmid to ensure that digestion by DpnI works well. For cloning purposes, I think that treatment of the destination plasmid digestion with antarctic phosphatase is generally sufficient for reducing the likelihood of cloning genomic DNA. So I would favor that approach over removing DpnI sites (given that the presence of DpnI sites is useful for site-directed mutagenesis).

GATC sites were included as per Drew's request.

Codon frequency

Rare codons were removed from the antibiotic resistance markers and ccdB.

Ordering information

Retrieved from "https://openwetware.org/mediawiki/index.php?title=Synthetic_Biology:Vectors/Parts&oldid=181636"