Swartz:Protocols/otDNA

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New page: HH-otDNA: GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC''CCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGC'''GCT'''GGTTCAAATCCG'''GCC'''CGCCGGACCA'' HH-...)
m
Line 1: Line 1:
HH-otDNA:
HH-otDNA:
-
GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC''CCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGC'''GCT'''GGTTCAAATCCG'''GCC'''CGCCGGACCA''
+
:GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC''CCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGC'''GCT'''GGTTCAAATCCG'''GCC'''CGCCGGACCA''
HH-otDNAOpt:
HH-otDNAOpt:
-
GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC''CCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGC'''AGG'''GGTTCAAATCC'''CCT'''CCGCCGGACCA''
+
:GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC''CCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGC'''AGG'''GGTTCAAATCC'''CCT'''CCGCCGGACCA''
:''Italics'': o-tDNA Sequence
:''Italics'': o-tDNA Sequence

Revision as of 17:44, 29 May 2012

HH-otDNA:

GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCCCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGCGCTGGTTCAAATCCGGCCCGCCGGACCA

HH-otDNAOpt:

GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCCCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGCAGGGGTTCAAATCCCCTCCGCCGGACCA
Italics: o-tDNA Sequence
Bold: Regions that have been mutated in o-tDNAOpt for better interaction with E. coli EfTu. (as per Young et al. 2010, J Mol Biol)
  1. Amplify the second sequence from pY71 HH-otDNAOpt plasmid using short end primers and house-made Pfu.
  2. Check on 1% w/v agarose gel to make sure that the linear template is the only product.
  3. Ethanol precipitate the nucleic acids in the solution (no PCR cleanup required):
    Add enough EDTA to obtain a concentration of 20 mM. EDTA is required to chelate Mg2+.
    Then, add enough sodium acetate (pH 5.5) to a final concentration of 300 mM.
    To this mixture, add 3 volumes of ethanol.
    Incubate on ice for 15-30 minutes.
  4. Resuspend the pellet in a buffer of choice. I used 10 mM Bis-Tris, pH 7.4.
  5. Measure [tDNA template] using Qubit assay.
  6. Titrate different amounts of the template to determine how much is required for your particular protein.
Personal tools