Swartz:Protocols/Linear DNA Template
From OpenWetWare
m |
Current revision (19:53, 28 May 2012) (view source) m |
||
| Line 119: | Line 119: | ||
Purify using QIAquick PCR purification kit. Elute using 50uL dH2O. Store at -20C. | Purify using QIAquick PCR purification kit. Elute using 50uL dH2O. Store at -20C. | ||
| - | [[Category:Swartz_Protocols]] | + | [[Category:Swartz_Protocols]][[Category:Cell_Free]] |
Current revision
See https://docs.google.com/document/d/1SImrjVvULhFQleGOoGGey4uJGKkJOxN0xnTy_QnqI8Q/edit
Linear DNA templates for coupled transcription-translation
Reagents
- Primers
- Gene-specific primers (see II.B)
- Primers for bacteriophage T7 promoter and terminator elements (see III.A)
- Single primer (see)
- Polymerases
- AccuPrime Pfx DNAP (Invitrogen)—for amplifying gene
- Vent DNAP (NEB)—for amplifying transcription regulatory elements
- Pfu DNAP (Stratagene)—for re-amplification
- Other
- QIAquick PCR Purification/Gel Extraction kit
- Other reagents for PCR like 25mM dNTPs
Amplification of gene product (see example in VI) Obtain DNA sequence for gene of interest. For E. coli genes, use http://ecocyc.org/ Use OligoPerfect Designer TM (Invitrogen) to design a sense (Fwd) and antisense (Rev) primer to amplify gene (http://www.invitrogen.com/content.cfm?pageid=9716) Unless the program is unable to find primers, use default settings for ‘Primer Size’, ‘Primer Tm’, and ‘Primer %GC’. All other settings are default. Try increasing the primer size or lowering the %GC if the program cannot identify primers. In the ‘Region to Amplify’ field, put in 1 to n, where n is the last nucleotide that you want amplified. Use a target annealing temperature of 55-60C Add the following 5’-extensions to your gene specific primers (see example VI.B.3) Sense 5’-extension: 5’ – gtttaactttaagaaggagatatacat -3’ Antisense 5’-extension: 5’ – cagcggtggcagcagccaactca -3’ Order standard primers (no need to purify or order special quantities) Gene-specific amplification Reagents (for 100uL PCR reactions) 10x AccuPrimer Pfx Reaction Mix (Invitrogen)# 1x 50mM MgSO4 0.3mM 1mg/mL gDNA# 2ug/mL 0.1 mM Fwd.primer 1uM 0.1 mM Rev.primer 1uM 2.5U/uL AccuPrime Pfx 2.5U Temperature cycle 1x: 95C/2min 25x: 95C/15s, 60C/30s, 68C/1min per kb 1x: 68C/5min, 10C/infinite Purification: Use a QIAquick PCR purification kit according to instructions. Elute using 50uL dH2O Storage: -20C Preparation of promoter and terminator elements Notes Order the following primers to amplify the T7 promoter (PT7.SP3) and T7 terminator (Term.SP3): PT7.SP3 (250bp product) FWD.PT7: 5’-ATGCAGGTCA TCCGAGGGGT TAACGAGTTC GCGGCCGCTT AGGCACCCCA GGCTTTAC-3’ REV.PT7: 5’-CATATGTATA TCTCCTTCTT AAAGTTAAAC AAAATGATCT CTAGATCG AAACCGTTGT GGTCTC-3’ Term.SP3 (170bp product) FWD.TERM: 5’-TGAGTTGGCT GCTGCCACCG CTG-3’
REV.TERM: 5’-ATGCAGGTCATCCGA GGGGTTAACG AGTTCGACGA GCGTCAGCTT GCATGCCCTG CAGCT-3’.
I normally amplify 2x-each PT7.SP3 and Term.SP3 every time I do a preparation. Amplification of T7 regulatory elements Amplifying PT7.SP3 #(for 50uL PCR reactions): 10x ThermoPol Buffer (NEB)# 1x 25 mM dNTPs (NEB) 250uM 1mg/mL pK7.CAT 2ug/mL 0.1 mM Fwd.PT7 1uM 0.1 mM Rev.PT7 1uM 2 U/uL Vent DNAP 2U Temperature cycle 1x: 95C/2min 25x: 95C/30s, 60C/30s, 72C/30s 1x: 72C/5min, 10C/infinite Purification: QIAquick Gel Extraction Kit Cast a large 2% (w/v) agarose gel. Use the small combs and tape 3x-wells together with electrical tape. Make 4 of these larger wells (1 for each PCR reaction: 2x-PT7.SP3 PCR and 2x-TERM.SP3 PCR; see note III.A.2) Rinse large gel box and add fresh TBE running buffer Add 10uL of 4x-Blue Juice dye per 50uL PCR reaction Load 60uL sample (50uL PCR + 10uL dye) into one large well Focus DNA products at 110V for 30min. Excise bands (PT7.SP3=250bp, TERM.SP3=150bp) and purify using QIAquick gel extraction kit. Elute using 50uL dH2O Storage: -20C Extension/Amplification of functional DNA template Notes: The quality of the gene product and the T7 regulatory elements are critical for this to work. Try to limit the accumulation of primer dimers in your PCR product and make sure you have good yields of the gene product and the regulatory elements. Order SP3 single primer: 5’-ATGCAGGTCA TCCGAGGGGT T-3’ Extension/Amplification to make full-length template Reagents for 50uL PCR reactions: Volume (uL): dH2O 35 10x ThermoPol Buffer (NEB) 5 25 mM dNTPs (NEB) 0.5 Amplified gene from II.D.4 2 PT7.SP3 from III.B.4 3 TERM.SP3 from III.B.4 3 2.5U/uL Vent DNAP 1.5 Program the thermal cycler (PCR machine) 1x: 95C/2min 10x: 95C/30s, 57C/1min, 72C/1min per kb 15x: 95C/30s, 67C/1min, 72C/1min per kb 1x: 72C/5min, 10C/infinite
Pause the PCR during the extension (T=72C) of the last 10x temperature cycle. Add 1uL of 0.1mM SP3 primer to each PCR tube. Mix by inverting several times. Place tube back in PCR machine and hit start to continue cycle. Analyze for an increase of 400bp relative to the size of your amplified gene product. Purification: No purification is required but for repeated freeze/thaws it is recommended to perform a PCR clean-up. Re-amplification of functional DNA template: The full-length product can be re-amplified by using the full-length product (IV.C.2) as a template and the SP3 single primer for amplification. Pfu DNAP from Stratagene is best for this application. I’ve run 50uL PCR reactions using 15xcycles at Ta=67C (see IV.C.2). Limit re-amplification of first-generation full-length products because continuous re-amplification leads to the formation of aberrant products. Example: groS (GroES chaperone) DNA sequence (from Ecocyc): ATGAATATTC GTCCATTGCA TGATCGCGTG ATCGTCAAGC GTAAAGAAGT TGAAACTAAA TCTGCTGGCG GCATCGTTCT GACCGGCTCT GCAGCGGCTA AATCCACCCG CGGCGAAGTG CTGGCTGTCG GCAATGGCCG TATCCTTGAA AATGGCGAAG TGAAGCCGCT GGATGTGAAA GTTGGCGACA TCGTTATTTT CAACGATGGC TACGGTGTGA AATCTGAGAA GATCGACAAT GAAGAAGTGT TGATCATGTC CGAAAGCGAC ATTCTGGCAA TTGTTGAAGC GTAA Gene-specific primers for amplifying groS gene (from OligoPerfect Designer TM). In the ‘Region to Amplify’ field, put in 1 to 294 (for groS, different for different genes). Gene-specific primers: Tm=60C (I arbitrarily chose the first set) Sense: 5’- ATGAATATTCGTCCATTGCATG -3’ Antisense: 5’- TTACGCTTCAACAATTGCCA -3’ Add 5’-extensions (use these primers for PCR amplification in VI.C): Fwd.groS: 5’- gtttaactttaagaaggagatatacatATGAATATTCGTCCATTG CATG -3’ Rev.groS: 5’ – cagcggtggcagcagccaactcaTTACGCTTCAACAATTGC CA -3’ Gene-specific PCR Reagents: Volume (uL) for 100uL PCR: dH2O 86.2 10x AccuPrimer Pfx Reaction Mix 10 50mM MgSO4 0.6 1mg/mL gDNA# 0.2 0.1 mM Fwd.primer 1 0.1 mM Rev.primer 1 2.5U/uL AccuPrime Pfx 1
Temperature cycle: Temperature cycle 1x: 95C/2min 25x: 95C/15s, 55C/30s, 68C/30s 1x: 68C/5min, 10C/infinite Visualize by loading 2uL PCR+2uL Blue Juice Dye (4X concentrated). Analyze on 1.3% (w/v) agarose for 0.3kb DNA band on a small gel (90V, 45min). Purify using QIAquick PCR purification kit. Elute using 50uL dH2O. Store at -20C.


