Stanford/BIOE44:Module3:Day2:atrazine

Atrazine Sensor Project

Authors: Claire Durkin, Frank Li, Sanjay Saraf

We propose 4 new BioBrick parts compatible with Assembly Standard 10:

Project Description: Pseudomonas sp. ADP digests atrazine under nitrogen starvation conditions. atzABC are constitutively expressed and convert atrazine to cyanuric acid. atzDEF convert cyanuric acid to carbon dioxide and ammonia, which the cell digests. The atzDEF operon is regulated by atzR, a protein that autoregulates its production in the same region. GlnK is produced under nitrogen limitation conditions and induces expression of atzDEF.

Here we reproduce the parts of this system, with the intent of creating a general atrazine sensor. Because Pseudomonas sp. ADP is hard to manipulate, we will be working in Pseudomonas putida KT2440.

1. reverse complement of atzR from Pseudomonas sp. ADP (969 bp)

2. reverse complement of constitutive promoter BBa_J23101 (35 bp)

3. atzDEF operator region from Pseudomonas sp. ADP (96 bp)

4. glnK from Pseudomonas putida KT2440 (339 bp)

---

Part 1: 1. reverse complement of atzR (969 bp) (bp #99885..100853 on Psuedomonas sp. ADP http://www.ncbi.nlm.nih.gov/nuccore/13937422)

Short Description: Reverse complement of the coding sequence for atzR, the regulator protein in the atzDEF pathway, in accordance with BioBrick assembly 10.

Sequence:

gaattcgcggccgcttctagagTTACGTTGCATTGTGGGTCGTATCAGCGAGCTTGCCGGCGACGAACTCC GCAAATGCCGCCGATGCCACAGGCAGCACCCTCTCACGCAATGCGACCAGTACGACGCGTCCGGAAGCCAG GCTGCGCTCGTCGATTGGAATTGCAACCTCACCCTCCGTGGAACCAGCACCGATCTCGATCTGAAAGCTCA CCCCACCGGTTTCGCGGGCAAAACCGCGCATCATTTCGTAGGAATTACTGACCAGTTGAGGCCGCGGTCGA GCTGATGATTTGTCGAATAACTCGTCCAACACGTTGCGCCCGGAGAGACTGCTGTCCGGTAGCGCAAGGGG GTAGTCCAGGCAATCTTTCAGACGCAGACTCGTACGCTTCGCGAGCGGATGGTCGGAAGCAACGACGGCAC AGATGCGTTGCCGCGCTTGTGCAATGACAGTCAAACCGCGCAGGTCCGGGGGATTGAAGACCAGCGCCAGG TCGGCCGCGAAATCCGTCACGGCGAGAACAGCACGCTCGCGGTCCAGCACCTTTACGTCGAAGGCAATACC TGGACGTTGGGCCTGGAACGCGTGTATTACGCGGGGCAGGAACTCCGGAGCCAGCGCCTGGCTGGCTGCCA ATGTCACACGGCCGCGTTTCATGCCGCTGAGATCCTGGATCTGTGACTGGACTTGTTCCAGATCGGCATTG CGGCGACGAGCGTAGGCAACGAACAGTTCGCCTGCCGCAGTCAGGCGTACACCACGCGGCAGACGCTCGAA AATCGGCGTACCTAACTCGTATTCCAGATCCTGGACGCGGCGATTTACCGCTGATGCGGCGACGTGCAGCT GTTCTGCGGCGGCCCGAATGGAGCCGCAGCGAGCCACGGCATCGATGTAATGAAGAAAGCGTAAATGTTGC ATAGGTGGTCGAAGTAAAAAGGATGGAATAGAGATGGCCTGTATCGCTGACGGCCGCTGTGCCCGCATtac tagtagcggccgctgcag

We made 4 silent point mutations to make this sequence conform to Assembly Standard 10: 3 for EcoRI and 1 for NotI. We also edited to make TAA the stop codon.

---

Part 2: 2. reverse complement of constitutive promoter BBa_J23101 (35bp) (from http://partsregistry.org/Part:BBa_J23101:Design)

Short Description: Reverse complement constitutive promoter that will be used for the reverse complement CDS of part 1.

Sequence:

gaattcgcggccgcttctagagGCTAGCATAATACCTAGGACTGAGCTAGCTGTAAAtactagtagcggccgctgcag

We did not make any mutations to this sequence.

---

Part 3: 3. atzDEF operator region (96 bp) (bp #100851..100946 on Psuedomonas sp. ADP http://www.ncbi.nlm.nih.gov/nuccore/13937422)

Short Description: Operon region for the atrR and atzDEF genes that is sensitive to the presence of cyanuric acid. It is controlled by the the AtzR protein which binds and blocks/represses the atzR and atzDEF promoter regions. The presence of cyanuric acid “frees” AtzR from being bound to the atzDEF promoter so polymerase can now bind and transcribe following gene. AtzR remains bound to the atzR promoter region even in the presence of cyanuric acid.

Sequence:

gaattcgcggccgcttctagagCATGCGAGTCAAAGCAAGATCGGTGCCGGATCGGCACCAGTTAGGTCGGAAAAAGG CGGCAGTCAAGTGCGCAGGGCGGCGTTAAGCTTGAACGAAtactagtagcggccgctgcag

We did not make any mutations to this sequence.

---

Part 4:

4. glnK from Pseudomonas putida KT2440 (339 bp) (bp #5967730..5968070 on Psuedomonas putida KT2440 http://www.ncbi.nlm.nih.gov/nuccore/NC_009512)

Short Description: GlnK is a nitrogen regulatory protein that is needed for forcing the system to exhibit a nitrogen-limited scenario. GlnK protein is a member of the trimeric PII signal transduction protein family. GlnK aids in the expression of atzR by demonstrating nitrogen limitation. Plans are to constitutively express GlnK in order to make the system sensitive to cyanuric acid. Below is the coding sequence for GlnK, regulator of nitrogen sensitivity in Pseudomonas putida.

Sequence:

gaattcgcggccgcttctagATGAAGCTAGTCACAGCCATCATCAAGCCGTTCAAGCTGGACGACGTGCGCGAGTCGCT GTCGGAAATCGGCGTGCAGGGCATCACCGTCACCGAAGTCAAAGGTTTCGGTCGGCAGAAGGGCCACACCGAGCTGTAT CGCGGTGCTGAATATGTGGTCGATTTCCTGCCCAAGGTGAAGATCGATGTCGCCATCGATGACAAAGACCTTGATCGGG TAATCGAAGCCATCACCAAGGCAGCCAACACCGGCAAGATCGGTGACGGCAAGATTTTCGTGGTGAATCTGGAGCAGGC GATCCGCATCCGTACCGGCGAAACCGATACCGACGCGATCTAAtactagtagcggccgctgcag

We did not make any mutations to this sequence.

---

References: Ana B. Hervás, Inés Canosa, et al. NtrC-Dependent Regulatory Network for Nitrogen Assimilation in Pseudomonas putida; J Bacteriol. 2009 Oct;191(19):6123-35. Epub 2009 Jul 31.

García-González V, Govantes F, Porrúa O, Santero E. Regulation of the Pseudomonas sp. strain ADP cyanuric acid degradation operon. J Bacteriol. 2005 Jan;187(1):155-67. Centro Andaluz de Biología del Desarrollo, Universidad Pablo de Olavide, Carretera de Utrera, Km. 1, 41013, Seville, Spain.

García-González V, Jiménez-Fernández A, Hervás AB, Canosa I, Santero E, Govantes F. Distinct roles for NtrC and GlnK in nitrogen regulation of the Pseudomonas sp. strain ADP cyanuric acid utilization operon. FEMS Microbiol Lett. 2009 Nov;300(2):222-9. Epub 2009 Sep 4. Departamento de Biología Molecular e Ingeniería Bioquímica, Centro Andaluz de Biología del Desarrollo, Universidad Pablo de Olavide/CSIC, Carretera de Utrera, Km. 1, Seville, Spain.

Porrúa O, Platero AI, Santero E, Del Solar G, Govantes F. Complex interplay between the LysR-type regulator AtzR and its binding site mediates atzDEF activation in response to two distinct signals. Mol Microbiol. 2010 Feb 28. [Epub ahead of print] Centro Andaluz de Biología del Desarrollo, Universidad Pablo de Olavide/CSIC, and Departamento de Biología Molecular e Ingeniería Bioquímica, Universidad Pablo de Olavide. Carretera de Utrera, Km. 1. 41013 Sevilla, Spain. Department of Protein structure and function. Centro de Investigaciones Biológicas, CSIC. Ramiro de Maeztu 9, 28040 Madrid.