Stanford/BIOE44:Module3:Day2:atrazine: Difference between revisions
No edit summary |
No edit summary |
||
| Line 10: | Line 10: | ||
1. reverse complement of atzR from Pseudomonas sp. ADP (969 bp) | 1. reverse complement of atzR from Pseudomonas sp. ADP (969 bp) | ||
2. reverse complement of constitutive promoter BBa_J23101 (35 bp) | 2. reverse complement of constitutive promoter BBa_J23101 (35 bp) | ||
3. atzDEF operator region from Pseudomonas sp. ADP (96 bp) | 3. atzDEF operator region from Pseudomonas sp. ADP (96 bp) | ||
4. glnK from Psuedomonas putida KT2440 (339 bp) | 4. glnK from Psuedomonas putida KT2440 (339 bp) | ||
| Line 58: | Line 61: | ||
4. glnK from Pseudomonas putida KT2440 (339 bp) (bp #5967730..5968070 on Psuedomonas putida KT2440 http://www.ncbi.nlm.nih.gov/nuccore/NC_009512) | 4. glnK from Pseudomonas putida KT2440 (339 bp) (bp #5967730..5968070 on Psuedomonas putida KT2440 http://www.ncbi.nlm.nih.gov/nuccore/NC_009512) | ||
'''Short Description:''' | '''Short Description:''' Coding sequence for GlnK, regulator of nitrogen sensitivity in Pseudomonas putida. | ||
'''Sequence:''' | '''Sequence:''' | ||
| Line 67: | Line 68: | ||
aaggcagccaacaccggcaagatcggtgacggcaagattttcgtggtgaatctggagcaggcgatccgcatccgtaccggcgaaaccgataccgacgcgatctaatactagtagcggccgctgcag | aaggcagccaacaccggcaagatcggtgacggcaagattttcgtggtgaatctggagcaggcgatccgcatccgtaccggcgaaaccgataccgacgcgatctaatactagtagcggccgctgcag | ||
----- | |||
'''References:''' | |||
Ana B. Hervás, Inés Canosa, et al. NtrC-Dependent Regulatory Network for Nitrogen Assimilation in Pseudomonas putida; J Bacteriol. 2009 Oct;191(19):6123-35. Epub 2009 Jul 31. | Ana B. Hervás, Inés Canosa, et al. NtrC-Dependent Regulatory Network for Nitrogen Assimilation in Pseudomonas putida; J Bacteriol. 2009 Oct;191(19):6123-35. Epub 2009 Jul 31. | ||
Revision as of 15:32, 4 May 2010
Atrazine Sensor Project
Authors: Claire Durkin, Frank Li, Sanjay Saraf
We propose 4 new BioBrick parts compatible with Assembly Standard 10:
Project Description: Pseudomonas sp. ADP digests atrazine under nitrogen starvation conditions. atzABC are constitutively expressed and convert atrazine to cyanuric acid. atzDEF convert cyanuric acid to carbon dioxide and ammonia, which the cell digests. The atzDEF operon is regulated by atzR, a protein that autoregulates its production in the same region. GlnK is produced under nitrogen limitation conditions and induces expression of atzDEF.
Here we reproduce the parts of this system, with the intent of creating a general atrazine sensor. Because Pseudomonas sp. ADP is hard to manipulate, we will be working in Pseudomonas putida KT2440.
1. reverse complement of atzR from Pseudomonas sp. ADP (969 bp)
2. reverse complement of constitutive promoter BBa_J23101 (35 bp)
3. atzDEF operator region from Pseudomonas sp. ADP (96 bp)
4. glnK from Psuedomonas putida KT2440 (339 bp)
Part 1: 1. reverse complement of atzR (969 bp) (bp #99885..100853 on Psuedomonas sp. ADP http://www.ncbi.nlm.nih.gov/nuccore/13937422)
Short Description: Reverse complement of the coding sequence for atzR, the regulator protein in the atzDEF pathway, in accordance with BioBrick assembly 10.
Sequence: gaattcgcggccgcttctagagtcacgttgcattgtgggtcgtatcagcgagcttgccggcgacgaactccgcaaatgccgccgatgccacaggcagcaccctctcacgcaatgcgaccagtacga cgcgtccggaagccaggctgcgctcgtcgattggaattgcaacctcaccctccgtggaaccagcaccgatctcgatctgaaagctcaccccaccggtttcgcgggcaaaaccgcgcatcatttcgt aggaattactgaccagttgaggccgcggtcgagctgatgatttgtcgaataactcgtccaacacgttgcgcccggagagactgctgtccggtagcgcaagggggtagtccaggcaatctttcagac gcagactcgtacgcttcgcgagcggatggtcggaagcaacgacggcacagatgcgttgccgcgcttgtgcaatgacagtcaaaccgcgcaggtccgggggattgaagaccagcgccaggtcggccg cgaaatccgtcacggcgagaacagcacgctcgcggtccagcacctttacgtcgaaggcaatacctggacgttgggcctggaacgcgtgtattacgcggggcaggaactccggagccagcgcctggc tggctgccaatgtcacacggccgcgtttcatgccgctgagatcctggatctgtgactggacttgttccagatcggcattgcggcgacgagcgtaggcaacgaacagttcgcctgccgcagtcaggc gtacaccacgcggcagacgctcgaaaatcggcgtacctaactcgtattccagatcctggacgcggcgatttaccgctgatgcggcgacgtgcagctgttctgcggcggcccgaatggagccgcagc gagccacggcatcgatgtaatgaagaaagcgtaaatgttgcataggtggtcgaagtaaaaaggatggaatagagatggcctgtatcgctgacggccgctgtgcccgcattactagtagcggccgct gcag
Part 2: 2. reverse complement of constitutive promoter BBa_J23101 (35bp) (from http://partsregistry.org/Part:BBa_J23101:Design)
Short Description: Reverse complement that will be used for the reverse complement CDS of part 1.
Sequence: gaattcgcggccgcttctagaggctagcataatacctaggactgagctagctgtaaatactagtagcggccgctgcag
Part 3: 3. atzDEF operator region (96 bp) (bp #100851..100946 on Psuedomonas sp. ADP http://www.ncbi.nlm.nih.gov/nuccore/13937422)
Short Description: ??
Sequence: gaattcgcggccgcttctagagcatgcgagtcaaagcaagatcggtgccggatcggcaccagttaggtcggaaaaaggcggcagtcaagtgcgcagggcggcgttaagcttgaacgaatactagta gcggccgctgcag
Part 4:
GlnK is a nitrogen regulatory protein that is needed for forcing the system to exhibit a nitrogen-limited scenario. GlnK protein is a member of the trimeric PII signal transduction protein family. GlnK aids in the expression of atzR by demonstrating nitrogen limitation. Plans are to constitutively express GlnK in order to make the system sensitive to cyanuric acid.
4. glnK from Pseudomonas putida KT2440 (339 bp) (bp #5967730..5968070 on Psuedomonas putida KT2440 http://www.ncbi.nlm.nih.gov/nuccore/NC_009512)
Short Description: Coding sequence for GlnK, regulator of nitrogen sensitivity in Pseudomonas putida.
Sequence: gaattcgcggccgcttctagatgaagctagtcacagccatcatcaagccgttcaagctggacgacgtgcgcgagtcgctgtcggaaatcggcgtgcagggcatcaccgtcaccgaagtcaaaggttt cggtcggcagaagggccacaccgagctgtatcgcggtgctgaatatgtggtcgatttcctgcccaaggtgaagatcgatgtcgccatcgatgacaaagaccttgatcgggtaatcgaagccatcacc aaggcagccaacaccggcaagatcggtgacggcaagattttcgtggtgaatctggagcaggcgatccgcatccgtaccggcgaaaccgataccgacgcgatctaatactagtagcggccgctgcag
References: Ana B. Hervás, Inés Canosa, et al. NtrC-Dependent Regulatory Network for Nitrogen Assimilation in Pseudomonas putida; J Bacteriol. 2009 Oct;191(19):6123-35. Epub 2009 Jul 31.
