Recent Changes

From OpenWetWare

Jump to: navigation, search

Track the most recent changes to the wiki on this page.

Below are the last 250 changes in the last 7 days, as of 20:25, 24 October 2014.
Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Hide minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 20:25, 24 October 2014
i
Limit to categories (separate with "|")  Any

24 October 2014

+      20:21 Team DNAbeans‎ (11 changes) . . (+1,123) . . (Page history) [Alex Hoppe‎ (11×)]
+      20:16 Biomod/2014/OhioMOD/results‎ (3 changes) . . (+3,634) . . (Page history) [Anudeep Singh Lotey‎ (3×)]
+      20:14 Biomod/2014/UCR/Breaking RNA/Project‎ (26 changes) . . (-4,905) . . (Page history) [Hari K. K. Subramanian‎ (12×); Elisa‎ (14×)]
       20:13 Biomod/2014/Fukuoka (diff; hist) . .  (+2,037) . . Team Fukuoka (Talk | contribs)
+      20:10 Biomod/2014/HKBUteam/projectideas‎ (3 changes) . . (+1,483) . . (Page history) [Jonathan Chan‎ (3×)]
       19:35 Biomod/2014/VCCRI/LabBook (diff; hist) . .  (+1) . . Jon Berengut (Talk | contribs)
+      19:30 Biomod/2014/Folding‎ (7 changes) . . (+89) . . (Page history) [Johann Bohlen‎ (2×); R. Matis‎ (5×)]
+      19:21 Biomod/2014/UCR/Breaking RNA/Acknowledgements‎ (14 changes) . . (+2,229) . . (Page history) [Jonathan J. Lloyd‎; Claire H. Tran‎ (2×); Elisa‎ (2×); Christopher J. Galley‎ (9×)]
+      18:58 Biomod/2014/OhioMOD/project‎ (4 changes) . . (+7,489) . . (Page history) [Anudeep Singh Lotey‎ (4×)]
       18:48 Biomod/2014/VCCRI/Project/Solution (diff; hist) . .  (+444) . . Jon Berengut (Talk | contribs)
  N    18:34 Biomod/2014/CACGTAATTGACGCCAGCTTTGAAT (diff; hist) . .  (+18,999) . . Johann Bohlen (Talk | contribs) (New page: <html> <head> <title> Mainpage </title> <style> body{ align: left; width: 1200px; height: auto; margin: 0 auto; background-color:#be1e3c; border:#b...)
+      18:32 Biomod/2014/Design‎ (3 changes) . . (-25) . . (Page history) [Johann Bohlen‎; R. Matis‎ (2×)]
+      18:05 Biomod/2014/UCR/Breaking RNA/Results‎ (25 changes) . . (+1,796) . . (Page history) [Jonathan J. Lloyd‎ (3×); Hari K. K. Subramanian‎ (22×)]
+      17:43 Biomod/2014/perspectives‎ (10 changes) . . (+12,445) . . (Page history) [Johann Bohlen‎ (4×); R. Matis‎ (6×)]
+      17:40 Biomod/2014/Kashiwa/Experiments‎ (49 changes) . . (+17,043) . . (Page history) [Reika Tei‎ (49×)]
+      17:21 Biomod/2014/Fluorescence‎ (5 changes) . . (+9,804) . . (Page history) [R. Matis‎; Johann Bohlen‎ (4×)]
+      17:20 Biomod/2014/results‎ (25 changes) . . (+7,178) . . (Page history) [Johann Bohlen‎ (9×); R. Matis‎ (16×)]
       17:18 Biomod/2014/idea (diff; hist) . .  (+57) . . R. Matis (Talk | contribs)
+      16:53 Biomod/2014‎ (3 changes) . . (+36) . . (Page history) [ShawnDouglas‎; Dresden Dnamic‎ (2×)]
+      16:12 Biomod/2014/VCCRI‎ (3 changes) . . (+51) . . (Page history) [Jon Berengut‎ (3×)]
+      15:01 Biomod/2014/fit test.html‎ (3 changes) . . (+677) . . (Page history) [Team Fukuoka‎ (3×)]
+      14:56 Biomod/2014/Braunschweig‎ (2 changes) . . (+239) . . (Page history) [R. Matis‎ (2×)]
+      14:50 20.109(F14)‎ (2 changes) . . (-15) . . (Page history) [AgiStachowiak‎ (2×)]
       14:17 Biomod/2014/Kashiwa (diff; hist) . .  (0) . . Reika Tei (Talk | contribs)
       12:35 Biomod/2014/Komaba (diff; hist) . .  (-1,230) . . Hiroki Nishizawa (Talk | contribs) (Replacing page with 'editing')
+ N    12:31 Biomod/2014/sitemap‎ (6 changes) . . (+277) . . (Page history) [Jonathan Chan‎ (6×)]
+      12:20 Biomod/2014/HKBUteam/methodology‎ (17 changes) . . (+105) . . (Page history) [Jonathan Chan‎ (17×)]
+      12:07 Biomod/2014/Team‎ (2 changes) . . (-466) . . (Page history) [R. Matis‎ (2×)]
+      12:02 Biomod/2014/Kansai/Experiment‎ (6 changes) . . (+2,260) . . (Page history) [Shota Nakagwa‎ (6×)]
+      11:26 Biomod/2014/HKBUteam/experimentalresults‎ (7 changes) . . (+38) . . (Page history) [Jonathan Chan‎ (7×)]
+      10:22 Biomod/2014/HKBUteam‎ (2 changes) . . (+29) . . (Page history) [Jonathan Chan‎ (2×)]
       10:12 Biomod/2014/HKBUteam/team (diff; hist) . .  (+2,119) . . Jonathan Chan (Talk | contribs) (Supervisors: )
       10:04 Biomod/2014/Hokudai/FUTURE (diff; hist) . .  (+1,568) . . Tomoki Fukushima (Talk | contribs)
       09:34 Biomod/2014/Sponsoren (diff; hist) . .  (-15) . . R. Matis (Talk | contribs)
       09:34 Biomod/2014/VCCRI/Project/Problem (diff; hist) . .  (+2,098) . . Cyril Tang (Talk | contribs)
       08:21 Biomod/2014/VCCRI/Sketchbook (diff; hist) . .  (-1) . . Robert Oppenheimer (Talk | contribs)
Views
Personal tools