Recent Changes

From OpenWetWare

Jump to: navigation, search

Track the most recent changes to the wiki on this page.

Below are the last 50 changes in the last 7 days, as of 19:25, 24 October 2014.
Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Hide minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 19:25, 24 October 2014
i
Limit to categories (separate with "|")  Any

24 October 2014

+      19:21 Biomod/2014/UCR/Breaking RNA/Acknowledgements‎ (9 changes) . . (+1,239) . . (Page history) [Christopher J. Galley‎ (9×)]
       19:14 User:Kristine de Leon (diff; hist) . .  (-91) . . Dawson Fairbanks (Talk | contribs)
+      19:10 (Upload log)‎ [Christopher J. Galley‎ (3×); Jon Berengut‎ (3×)]
+      18:58 Biomod/2014/OhioMOD/project‎ (4 changes) . . (+7,489) . . (Page history) [Anudeep Singh Lotey‎ (4×)]
       18:48 Biomod/2014/VCCRI/Project/Solution (diff; hist) . .  (+444) . . Jon Berengut (Talk | contribs)
+      18:37 Biomod/2014/UCR/Breaking RNA/Project‎ (13 changes) . . (-5,324) . . (Page history) [Hari K. K. Subramanian‎ (5×); Elisa‎ (8×)]
  N    18:34 Biomod/2014/CACGTAATTGACGCCAGCTTTGAAT (diff; hist) . .  (+18,999) . . Johann Bohlen (Talk | contribs) (New page: <html> <head> <title> Mainpage </title> <style> body{ align: left; width: 1200px; height: auto; margin: 0 auto; background-color:#be1e3c; border:#b...)
+      18:33 Biomod/2014/Folding‎ (3 changes) . . (+40) . . (Page history) [Johann Bohlen‎; R. Matis‎ (2×)]
       18:32 Biomod/2014/Design (diff; hist) . .  (-25) . . Johann Bohlen (Talk | contribs)
+      18:05 Biomod/2014/UCR/Breaking RNA/Results‎ (2 changes) . . (+460) . . (Page history) [Hari K. K. Subramanian‎; Jonathan J. Lloyd‎]
+      17:43 Biomod/2014/perspectives‎ (3 changes) . . (-24) . . (Page history) [R. Matis‎ (3×)]
       17:41 Griffin:Lentivirus Technology (diff; hist) . .  (+3) . . Korey Griffin (Talk | contribs)
+      17:40 Biomod/2014/Kashiwa/Experiments‎ (2 changes) . . (+2,236) . . (Page history) [Reika Tei‎ (2×)]
       17:21 Biomod/2014/Fluorescence (diff; hist) . .  (+6) . . R. Matis (Talk | contribs)
       17:20 Biomod/2014/results (diff; hist) . .  (+1) . . R. Matis (Talk | contribs)
       17:18 Biomod/2014/idea (diff; hist) . .  (+57) . . R. Matis (Talk | contribs)
Views
Personal tools