User contributions
From OpenWetWare
(Latest | Earliest) View (newer 250) (older 250) (20 | 50 | 100 | 250 | 500)
- 06:59, 20 May 2013 (hist) (diff) N User talk:Yingshan Hsu (User talk:Yingshan Hsu moved to User talk:Polly Yingshan Hsu: Automatically moved page while renaming the user "Yingshan Hsu" to "Polly Yingshan Hsu") (top)
- 06:59, 20 May 2013 (hist) (diff) N User:Yingshan Hsu (User:Yingshan Hsu moved to User:Polly Yingshan Hsu: Automatically moved page while renaming the user "Yingshan Hsu" to "Polly Yingshan Hsu") (top)
- 06:59, 20 May 2013 (hist) (diff) m User talk:Polly Yingshan Hsu (User talk:Yingshan Hsu moved to User talk:Polly Yingshan Hsu: Automatically moved page while renaming the user "Yingshan Hsu" to "Polly Yingshan Hsu") (top)
- 06:59, 20 May 2013 (hist) (diff) m User:Polly Yingshan Hsu (User:Yingshan Hsu moved to User:Polly Yingshan Hsu: Automatically moved page while renaming the user "Yingshan Hsu" to "Polly Yingshan Hsu")
- 13:38, 21 February 2013 (hist) (diff) Wikiomics:Biblio (top)
- 11:40, 15 August 2012 (hist) (diff) Escherichia coli/Codon usage
- 19:50, 25 February 2012 (hist) (diff) Synthetic Biology:Mailing lists (top)
- 10:27, 17 March 2011 (hist) (diff) N User:Elianna L. Goldstein (User:Elianna L. Goldstein moved to User:Elianna L. Peak: Automatically moved page while renaming the user "Elianna L. Goldstein" to "Elianna L. Peak") (top)
- 10:27, 17 March 2011 (hist) (diff) m User:Elianna L. Peak (User:Elianna L. Goldstein moved to User:Elianna L. Peak: Automatically moved page while renaming the user "Elianna L. Goldstein" to "Elianna L. Peak")
- 10:20, 11 March 2011 (hist) (diff) N User talk:Derek MacKlin (User talk:Derek MacKlin moved to User talk:Derek Macklin: Automatically moved page while renaming the user "Derek MacKlin" to "Derek Macklin") (top)
- 10:20, 11 March 2011 (hist) (diff) m User talk:Derek Macklin (User talk:Derek MacKlin moved to User talk:Derek Macklin: Automatically moved page while renaming the user "Derek MacKlin" to "Derek Macklin") (top)
- 10:20, 11 March 2011 (hist) (diff) N User:Derek MacKlin (User:Derek MacKlin moved to User:Derek Macklin: Automatically moved page while renaming the user "Derek MacKlin" to "Derek Macklin") (top)
- 10:20, 11 March 2011 (hist) (diff) m User:Derek Macklin (User:Derek MacKlin moved to User:Derek Macklin: Automatically moved page while renaming the user "Derek MacKlin" to "Derek Macklin") (top)
- 11:52, 23 November 2010 (hist) (diff) m Dewikify:Synthetic Biology (Reverted edits by Xiaoming He (Talk) to last version by Austin J. Che)
- 16:49, 9 November 2010 (hist) (diff) m E. coli genotypes (→TOP10 (Invitrogen))
- 10:05, 14 October 2010 (hist) (diff) MediaWiki:Common.js (top)
- 10:15, 16 July 2010 (hist) (diff) m Dewikify:Synthetic Biology (Reverted edits by Cristina Malagelada Grau (Talk) to last version by Austin J. Che)
- 11:43, 27 April 2010 (hist) (diff) Sandbox
- 08:47, 23 April 2010 (hist) (diff) N M Li (M Li moved to Knight over redirect: move page back) (top)
- 08:47, 23 April 2010 (hist) (diff) m Knight (M Li moved to Knight over redirect: move page back) (top)
- 18:46, 2 February 2010 (hist) (diff) m Dewikify:Default (Protected "Dewikify:Default" [edit=sysop:move=sysop]) (top)
- 18:46, 2 February 2010 (hist) (diff) m Dewikify:Default (Reverted edits by Paulo Kofuji (Talk) to last version by Austin J. Che)
- 18:26, 2 February 2010 (hist) (diff) m Dewikify:Default (Reverted edits by Paulo Kofuji (Talk) to last version by Austin J. Che)
- 12:51, 14 December 2009 (hist) (diff) MediaWiki:Extensions/historynav.js (top)
- 11:24, 26 November 2009 (hist) (diff) m Dewikify:Default (Reverted edits by Ruixin Zhu (Talk) to last version by Austin J. Che)
- 17:03, 1 July 2009 (hist) (diff) User:Austin J. Che (top)
- 10:48, 23 June 2009 (hist) (diff) Knight:Orders
- 16:15, 10 June 2009 (hist) (diff) Knight:Orders
- 16:18, 3 June 2009 (hist) (diff) Knight:Orders
- 16:03, 3 June 2009 (hist) (diff) Knight:Orders
- 15:49, 3 June 2009 (hist) (diff) Knight:Orders
- 14:18, 3 June 2009 (hist) (diff) Knight:Orders
- 22:09, 29 May 2009 (hist) (diff) Knight:Orders
- 18:31, 29 May 2009 (hist) (diff) Knight:Orders
- 08:45, 6 May 2009 (hist) (diff) User:Austin J. Che/monobook.js (top)
- 12:41, 4 May 2009 (hist) (diff) User:Steven J. Koch/Recent activity
- 17:08, 26 April 2009 (hist) (diff) OpenWetWare:Username policy
- 12:30, 23 April 2009 (hist) (diff) Knight:Orders
- 17:44, 19 April 2009 (hist) (diff) N User talk:Demir Akin, DVM, Phd (User talk:Demir Akin, DVM, Phd moved to User talk:Demir Akin: Automatically moved page while renaming the user "Demir Akin, DVM, Phd" to "Demir Akin") (top)
- 17:44, 19 April 2009 (hist) (diff) N User:Demir Akin, DVM, Phd (User:Demir Akin, DVM, Phd moved to User:Demir Akin: Automatically moved page while renaming the user "Demir Akin, DVM, Phd" to "Demir Akin") (top)
- 17:44, 19 April 2009 (hist) (diff) m User talk:Demir Akin (User talk:Demir Akin, DVM, Phd moved to User talk:Demir Akin: Automatically moved page while renaming the user "Demir Akin, DVM, Phd" to "Demir Akin") (top)
- 17:44, 19 April 2009 (hist) (diff) m User:Demir Akin (User:Demir Akin, DVM, Phd moved to User:Demir Akin: Automatically moved page while renaming the user "Demir Akin, DVM, Phd" to "Demir Akin") (top)
- 13:39, 17 April 2009 (hist) (diff) Knight:Orders
- 14:52, 4 April 2009 (hist) (diff) The BioBricks Foundation:Standards/Technical/Formats
- 14:45, 4 April 2009 (hist) (diff) BBF RFC 20 (top)
- 14:33, 4 April 2009 (hist) (diff) BBF RFC 20
- 11:54, 4 April 2009 (hist) (diff) BBF RFC 20
- 14:42, 3 April 2009 (hist) (diff) Knight:Orders
- 11:37, 3 April 2009 (hist) (diff) BBF RFC 20
- 15:41, 31 March 2009 (hist) (diff) Knight:Orders
- 23:23, 30 March 2009 (hist) (diff) The BioBricks Foundation:RFC
- 14:43, 25 March 2009 (hist) (diff) Knight:Orders
- 12:48, 25 March 2009 (hist) (diff) The BioBricks Foundation:RFC
- 12:47, 25 March 2009 (hist) (diff) N Image:BBFRFC20.pdf (top)
- 10:44, 24 March 2009 (hist) (diff) Knight:Orders
- 18:41, 4 March 2009 (hist) (diff) Knight:Orders
- 16:57, 1 March 2009 (hist) (diff) Knight:Orders
- 17:44, 16 February 2009 (hist) (diff) Knight:Orders
- 11:25, 10 February 2009 (hist) (diff) OpenWetWare:Username policy
- 18:41, 6 February 2009 (hist) (diff) Knight:Orders
- 15:38, 4 February 2009 (hist) (diff) Knight:Orders
- 19:36, 2 February 2009 (hist) (diff) Knight:Orders
- 11:05, 22 January 2009 (hist) (diff) Knight:Orders (→Needs to be Ordered)
- 19:06, 8 December 2008 (hist) (diff) Knight:Orders
- 15:49, 24 November 2008 (hist) (diff) Knight:Orders
- 17:46, 24 September 2008 (hist) (diff) The BioBricks Foundation:Standards/Technical/Formats
- 17:36, 24 September 2008 (hist) (diff) m The BioBricks Foundation:Standards/Technical/Formats
- 20:14, 23 September 2008 (hist) (diff) m The BioBricks Foundation:Standards/Technical/Formats
- 16:21, 6 August 2008 (hist) (diff) User talk:Austin J. Che/Extensions/LatexDoc
- 14:48, 6 August 2008 (hist) (diff) User talk:Austin J. Che/Extensions/LatexDoc
- 13:42, 6 August 2008 (hist) (diff) User talk:Austin J. Che/Extensions/LatexDoc
- 21:20, 2 August 2008 (hist) (diff) OpenWetWare:Username policy
- 21:19, 2 August 2008 (hist) (diff) N User talk:Paulo De Oliveira (User talk:Paulo De Oliveira moved to User talk:Paulo de Oliveira: Automatically moved page while renaming the user "Paulo De Oliveira" to "Paulo de Oliveira") (top)
- 21:19, 2 August 2008 (hist) (diff) N User:Paulo De Oliveira (User:Paulo De Oliveira moved to User:Paulo de Oliveira: Automatically moved page while renaming the user "Paulo De Oliveira" to "Paulo de Oliveira") (top)
- 21:19, 2 August 2008 (hist) (diff) m User talk:Paulo de Oliveira (User talk:Paulo De Oliveira moved to User talk:Paulo de Oliveira: Automatically moved page while renaming the user "Paulo De Oliveira" to "Paulo de Oliveira") (top)
- 21:19, 2 August 2008 (hist) (diff) m User:Paulo de Oliveira (User:Paulo De Oliveira moved to User:Paulo de Oliveira: Automatically moved page while renaming the user "Paulo De Oliveira" to "Paulo de Oliveira") (top)
- 16:07, 25 July 2008 (hist) (diff) User talk:Austin J. Che/Extensions/LatexDoc
- 11:27, 19 July 2008 (hist) (diff) Knight:Orders
- 08:05, 17 July 2008 (hist) (diff) OpenWetWare:Username policy
- 08:04, 17 July 2008 (hist) (diff) N User talk:Ellis O.neill (User talk:Ellis O.neill moved to User talk:Ellis O'Neill: Automatically moved page while renaming the user "Ellis O.neill" to "Ellis O'Neill") (top)
- 08:04, 17 July 2008 (hist) (diff) N User:Ellis O.neill (User:Ellis O.neill moved to User:Ellis O'Neill: Automatically moved page while renaming the user "Ellis O.neill" to "Ellis O'Neill") (top)
- 08:04, 17 July 2008 (hist) (diff) m User talk:Ellis O'Neill (User talk:Ellis O.neill moved to User talk:Ellis O'Neill: Automatically moved page while renaming the user "Ellis O.neill" to "Ellis O'Neill") (top)
- 08:04, 17 July 2008 (hist) (diff) m User:Ellis O'Neill (User:Ellis O.neill moved to User:Ellis O'Neill: Automatically moved page while renaming the user "Ellis O.neill" to "Ellis O'Neill")
- 10:23, 16 July 2008 (hist) (diff) User:Austin J. Che/Extensions/history.js (top)
- 20:32, 15 July 2008 (hist) (diff) User:Austin J. Che/Extensions/history (top)
- 20:31, 15 July 2008 (hist) (diff) User:Austin J. Che/Extensions/history
- 20:30, 15 July 2008 (hist) (diff) User:Austin J. Che/Extensions/history.js
- 20:29, 15 July 2008 (hist) (diff) User:Austin J. Che/Extensions/history.js (Redirecting to MediaWiki:Extensions/historynav.js)
- 19:41, 15 July 2008 (hist) (diff) User:Austin J. Che/monobook.js
- 10:13, 6 July 2008 (hist) (diff) Help:Wiki questions
- 10:12, 6 July 2008 (hist) (diff) User talk:Austin J. Che/Extensions/LatexDoc
- 16:02, 30 June 2008 (hist) (diff) OpenWetWare:Username policy
- 16:02, 30 June 2008 (hist) (diff) N User talk:Noemie M Dorval C (User talk:Noemie M Dorval C moved to User talk:Noemie Manuelle Dorval Courchesne: Automatically moved page while renaming the user "Noemie M Dorval C" to "[[User:Noemie Manuelle Dorval Courchesne|Noemie Manuelle Dorval C) (top)
- 16:02, 30 June 2008 (hist) (diff) N User:Noemie M Dorval C (User:Noemie M Dorval C moved to User:Noemie Manuelle Dorval Courchesne: Automatically moved page while renaming the user "Noemie M Dorval C" to "[[User:Noemie Manuelle Dorval Courchesne|Noemie Manuelle Dorval Courchesne]) (top)
- 16:02, 30 June 2008 (hist) (diff) m User talk:Noemie Manuelle Dorval Courchesne (User talk:Noemie M Dorval C moved to User talk:Noemie Manuelle Dorval Courchesne: Automatically moved page while renaming the user "Noemie M Dorval C" to "[[User:Noemie Manuelle Dorval Courchesne|Noemie Manuelle Dorval C) (top)
- 16:02, 30 June 2008 (hist) (diff) m User:Noemie Manuelle Dorval Courchesne (User:Noemie M Dorval C moved to User:Noemie Manuelle Dorval Courchesne: Automatically moved page while renaming the user "Noemie M Dorval C" to "[[User:Noemie Manuelle Dorval Courchesne|Noemie Manuelle Dorval Courchesne])
- 21:42, 28 June 2008 (hist) (diff) OpenWetWare:Username policy
- 11:36, 26 June 2008 (hist) (diff) Synthetic Biology:DNA synthesis order reviews (top)
- 16:13, 24 June 2008 (hist) (diff) Knight:Orders
- 15:13, 24 June 2008 (hist) (diff) Knight:Orders
- 10:11, 21 June 2008 (hist) (diff) MediaWiki:Prefs-help-email (top)
- 10:11, 21 June 2008 (hist) (diff) MediaWiki:Prefs-help-realname (top)
- 16:13, 16 June 2008 (hist) (diff) Knight:Orders
- 14:52, 12 June 2008 (hist) (diff) m Synthetic Biology:DNA synthesis order reviews
- 12:08, 12 June 2008 (hist) (diff) Sandbox
- 12:02, 12 June 2008 (hist) (diff) Sandbox
- 12:02, 12 June 2008 (hist) (diff) Sandbox
- 08:29, 10 June 2008 (hist) (diff) SEED/2008/Schedule (top)
- 08:29, 10 June 2008 (hist) (diff) N Image:SEED final.doc (top)
- 17:55, 5 June 2008 (hist) (diff) Knight:Orders
- 19:01, 29 May 2008 (hist) (diff) GFP
- 18:53, 29 May 2008 (hist) (diff) GFP
- 11:21, 28 May 2008 (hist) (diff) Courses
- 09:59, 28 May 2008 (hist) (diff) N Gautier Lab:345aiepglne95fa2d4g662e112e00f1e5gg (Redirecting to Gautier Lab:345aiepglne95fa2d4g662e112e00f1e5gg.html) (top)
- 14:18, 21 May 2008 (hist) (diff) OpenWetWare:Username policy
- 14:17, 21 May 2008 (hist) (diff) N User talk:Carlo B. Parapara, Phd (User talk:Carlo B. Parapara, Phd moved to User talk:Carlo Parapara: Automatically moved page while renaming the user "Carlo B. Parapara, Phd" to "Carlo Parapara") (top)
- 14:17, 21 May 2008 (hist) (diff) N User:Carlo B. Parapara, Phd (User:Carlo B. Parapara, Phd moved to User:Carlo Parapara: Automatically moved page while renaming the user "Carlo B. Parapara, Phd" to "Carlo Parapara") (top)
- 14:17, 21 May 2008 (hist) (diff) m User talk:Carlo Parapara (User talk:Carlo B. Parapara, Phd moved to User talk:Carlo Parapara: Automatically moved page while renaming the user "Carlo B. Parapara, Phd" to "Carlo Parapara") (top)
- 14:17, 21 May 2008 (hist) (diff) m User:Carlo Parapara (User:Carlo B. Parapara, Phd moved to User:Carlo Parapara: Automatically moved page while renaming the user "Carlo B. Parapara, Phd" to "Carlo Parapara")
- 21:27, 19 May 2008 (hist) (diff) SEED/2008/Day 9 (top)
- 21:25, 19 May 2008 (hist) (diff) N SEED/2008/Day 10 (New page: == Morning == * Work on final projects and posters == Afternoon == * Lab cleanup * Final written + lab practical exam == Instructor prep == * Prepare lab final exam) (top)
- 10:26, 18 May 2008 (hist) (diff) OpenWetWare:Software/Projects/Chat (top)
- 10:01, 17 May 2008 (hist) (diff) Knight:Orders
- 09:31, 16 May 2008 (hist) (diff) Knight:Orders
- 09:08, 16 May 2008 (hist) (diff) Sandbox
- 08:54, 16 May 2008 (hist) (diff) Sandbox
- 08:47, 16 May 2008 (hist) (diff) N Sandbox (New page: <html> <div style="width:430px"><style>.mcrmeebo { display: block; background:url("http://widget.meebo.com/r.gif") no-repeat top right; } .mcrmeebo:hover { background:url("http://widget.me...)
- 07:29, 16 May 2008 (hist) (diff) OpenWetWare:Username policy
- 07:28, 16 May 2008 (hist) (diff) N User talk:Inge M.V. Thijs (User talk:Inge M.V. Thijs moved to User talk:Inge M. Thijs: Automatically moved page while renaming the user "Inge M.V. Thijs" to "Inge M. Thijs") (top)
- 07:28, 16 May 2008 (hist) (diff) N User:Inge M.V. Thijs (User:Inge M.V. Thijs moved to User:Inge M. Thijs: Automatically moved page while renaming the user "Inge M.V. Thijs" to "Inge M. Thijs") (top)
- 07:28, 16 May 2008 (hist) (diff) m User talk:Inge M. Thijs (User talk:Inge M.V. Thijs moved to User talk:Inge M. Thijs: Automatically moved page while renaming the user "Inge M.V. Thijs" to "Inge M. Thijs") (top)
- 07:28, 16 May 2008 (hist) (diff) m User:Inge M. Thijs (User:Inge M.V. Thijs moved to User:Inge M. Thijs: Automatically moved page while renaming the user "Inge M.V. Thijs" to "Inge M. Thijs")
- 19:32, 15 May 2008 (hist) (diff) LabName (Redirecting to Template:LabName)
- 12:32, 14 May 2008 (hist) (diff) User talk:Jakob Suckale
- 12:17, 14 May 2008 (hist) (diff) User talk:Jakob Suckale
- 16:56, 13 May 2008 (hist) (diff) m Help:Notebook (Reverted edits by Melissa S. Dulcich (Talk); changed back to last version by Ricardo Vidal)
- 19:43, 12 May 2008 (hist) (diff) N List:SoftwareTools (List:SoftwareTools moved to List:Softwaretools: lowercase name) (top)
- 19:43, 12 May 2008 (hist) (diff) m List:Softwaretools (List:SoftwareTools moved to List:Softwaretools: lowercase name)
- 09:47, 8 May 2008 (hist) (diff) Knight:Orders
- 11:59, 7 May 2008 (hist) (diff) m Knight:Orders
- 11:58, 6 May 2008 (hist) (diff) m Synthetic Biology:DNA synthesis order reviews
- 16:28, 28 April 2008 (hist) (diff) User talk:Austin J. Che/Extensions/LatexDoc
- 21:35, 26 April 2008 (hist) (diff) User talk:Austin J. Che
- 16:49, 26 April 2008 (hist) (diff) User talk:Austin J. Che
- 17:38, 22 April 2008 (hist) (diff) DNA Precipitation
- 17:37, 22 April 2008 (hist) (diff) DNA Precipitation
- 14:40, 22 April 2008 (hist) (diff) SEED/2008/Schedule
- 14:40, 22 April 2008 (hist) (diff) N Image:SEED HW8.pdf (top)
- 12:19, 21 April 2008 (hist) (diff) SEED/2008/Day 8 (top)
- 12:16, 21 April 2008 (hist) (diff) SEED/2008/Schedule
- 12:13, 21 April 2008 (hist) (diff) N SEED/2008/Sequences (New page: == Promoters == * J23101: gaattcgcggccgcttctagagtttacagctagctcagtcctaggtattatgctagctactagt * J23106: gaattcgcggccgcttctagagtttacggctagctcagtcctaggtatagtgctagctactagt * J23112: gaattcgcggc...) (top)
- 12:07, 21 April 2008 (hist) (diff) N SEED/2008/Sequencing (New page: Expected sequences are listed here: SEED/2008/Sequences Sequence results: (Raw chromatogram traces) 1. JK-1 <pre> NNNNNNNNTTNNgtGCCGAGAAGGcC...) (top)
- 12:04, 21 April 2008 (hist) (diff) N Image:SEED 2008 sequencing traces.zip (top)
- 15:26, 20 April 2008 (hist) (diff) OpenWetWare:Username policy
- 15:25, 20 April 2008 (hist) (diff) N User:BillHooker (User:BillHooker moved to User:Bill Hooker: Automatically moved page while renaming the user "BillHooker" to "Bill Hooker") (top)
- 15:25, 20 April 2008 (hist) (diff) m User:Bill Hooker (User:BillHooker moved to User:Bill Hooker: Automatically moved page while renaming the user "BillHooker" to "Bill Hooker")
- 16:38, 17 April 2008 (hist) (diff) Knight:Orders
- 11:41, 14 April 2008 (hist) (diff) Knight:Orders
- 16:57, 13 April 2008 (hist) (diff) Knight:Orders
- 14:19, 13 April 2008 (hist) (diff) SEED/2008/Day 8
- 14:06, 13 April 2008 (hist) (diff) SEED/2008/Day 7 (top)
- 12:28, 13 April 2008 (hist) (diff) Knight:Orders
- 12:00, 11 April 2008 (hist) (diff) Knight:Orders
- 17:33, 10 April 2008 (hist) (diff) Help:Chat (top)
- 15:05, 10 April 2008 (hist) (diff) MediaWiki:Sidebar
- 11:58, 10 April 2008 (hist) (diff) OpenWetWare:Steering committee next meeting
- 10:26, 10 April 2008 (hist) (diff) SEED/2008/Schedule
- 10:25, 10 April 2008 (hist) (diff) N Image:SEED Quiz3 Units.pdf (top)
- 10:23, 10 April 2008 (hist) (diff) SEED/2008/Day 6 (top)
- 11:46, 8 April 2008 (hist) (diff) N Wikiomics:BLAST tutorial (excercises) (Wikiomics:BLAST tutorial (excercises) moved to Wikiomics:BLAST tutorial (exercises): title spelling) (top)
- 11:46, 8 April 2008 (hist) (diff) m Wikiomics:BLAST tutorial (exercises) (Wikiomics:BLAST tutorial (excercises) moved to Wikiomics:BLAST tutorial (exercises): title spelling) (top)
- 17:13, 7 April 2008 (hist) (diff) Knight:Beta-galactosidase assay/96 well format (top)
- 09:52, 7 April 2008 (hist) (diff) N Cell counting/plating (New page: ==Overview== Count the number of viable cells in a culture via dilution plating. The following assumes E. coli cells but it should apply to any type of cells. ==Materials== * LB agar pla...)
- 09:40, 7 April 2008 (hist) (diff) N Cell counting (New page: Protocols for counting the number of cells in a culture: * /hemocytometer/ counting * /plating/ dilutions Category:Protocol) (top)
- 09:38, 7 April 2008 (hist) (diff) Cell Counting (Redirecting to Cell counting) (top)
- 09:37, 7 April 2008 (hist) (diff) N Cell Counting (Cell Counting moved to Cell counting/hemocytometer)
- 09:37, 7 April 2008 (hist) (diff) m Stevej:Cell counting/hemocytometer (Cell Counting moved to Cell counting/hemocytometer)
- 18:15, 4 April 2008 (hist) (diff) N Knight:Beta-galactosidase assay/Fluorescence (New page: See beta-galactosidase assay for other methods. This method uses 4-Methylumbelliferyl beta-D-galactopyranoside (MUG) for lacZ detection (Sigma M1633). MUG has the advantage that it ge...) (top)
- 18:08, 4 April 2008 (hist) (diff) Beta-galactosidase assay
- 17:05, 4 April 2008 (hist) (diff) SEED/2008/Day 6
- 16:48, 4 April 2008 (hist) (diff) Beta-galactosidase assay
- 16:48, 4 April 2008 (hist) (diff) Beta-galactosidase
- 16:46, 4 April 2008 (hist) (diff) Beta-galactosidase assay
- 09:13, 4 April 2008 (hist) (diff) SEED/2008/Day 6
- 09:10, 4 April 2008 (hist) (diff) SEED/2008/Day 5 (top)
- 19:11, 3 April 2008 (hist) (diff) Knight:Orders
- 18:35, 3 April 2008 (hist) (diff) N X-Gal (New page: X-Gal is the common short name for 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside. It is a substrate for beta-galactosidase (lacZ) and turns blue upon being cleaved. It is commo...)
- 18:31, 3 April 2008 (hist) (diff) IPTG
- 11:46, 2 April 2008 (hist) (diff) m AB medium
- 09:00, 1 April 2008 (hist) (diff) User:Austin J. Che/Extensions/history.js
- 19:42, 31 March 2008 (hist) (diff) User:Tk/monobook.js
- 19:29, 31 March 2008 (hist) (diff) User:Austin J. Che/Extensions/history.js
- 21:53, 27 March 2008 (hist) (diff) Knight:Orders
- 16:53, 27 March 2008 (hist) (diff) Knight:Orders
- 13:24, 24 March 2008 (hist) (diff) N Image:SEED HW5.pdf (top)
- 13:24, 24 March 2008 (hist) (diff) N Image:SEED HW5.doc (top)
- 13:23, 24 March 2008 (hist) (diff) SEED/2008/Schedule
- 13:23, 24 March 2008 (hist) (diff) SEED/2008/Schedule
- 07:48, 21 March 2008 (hist) (diff) Knight:Orders
- 17:01, 20 March 2008 (hist) (diff) SEED/2008/Schedule
- 14:36, 20 March 2008 (hist) (diff) Knight:Orders
- 14:33, 20 March 2008 (hist) (diff) Beta-galactosidase
- 14:23, 20 March 2008 (hist) (diff) Template talk:Hide (top)
- 14:21, 20 March 2008 (hist) (diff) Template:Hide (top)
- 14:15, 20 March 2008 (hist) (diff) OpenWetWare:Mailing lists
- 10:53, 19 March 2008 (hist) (diff) User:Austin J. Che/monobook.js
- 12:53, 16 March 2008 (hist) (diff) SEED/2008/Day 6
- 12:52, 16 March 2008 (hist) (diff) SEED/2008/Day 5
- 12:51, 16 March 2008 (hist) (diff) SEED/2008/Day 4 (top)
- 14:11, 13 March 2008 (hist) (diff) Knight:Orders
- 12:16, 13 March 2008 (hist) (diff) OpenWetWare:Username policy
- 12:15, 13 March 2008 (hist) (diff) N User talk:Stajich (User talk:Stajich moved to User talk:Jason E. Stajich: Automatically moved page while renaming the user "Stajich" to "Jason E. Stajich") (top)
- 12:15, 13 March 2008 (hist) (diff) N User:Stajich (User:Stajich moved to User:Jason E. Stajich: Automatically moved page while renaming the user "Stajich" to "Jason E. Stajich") (top)
- 12:15, 13 March 2008 (hist) (diff) m User talk:Jason E. Stajich (User talk:Stajich moved to User talk:Jason E. Stajich: Automatically moved page while renaming the user "Stajich" to "Jason E. Stajich") (top)
- 12:15, 13 March 2008 (hist) (diff) m User:Jason E. Stajich (User:Stajich moved to User:Jason E. Stajich: Automatically moved page while renaming the user "Stajich" to "Jason E. Stajich")
- 10:57, 13 March 2008 (hist) (diff) Help:Chat
- 20:05, 10 March 2008 (hist) (diff) MediaWiki:Monobook.css
- 20:02, 10 March 2008 (hist) (diff) MediaWiki:Monobook.css
- 17:56, 9 March 2008 (hist) (diff) User talk:Ming Yi (top)
- 14:12, 9 March 2008 (hist) (diff) SEED/2008/Day 3 (top)
- 14:12, 9 March 2008 (hist) (diff) SEED/2008/Day 4
- 19:25, 7 March 2008 (hist) (diff) SEED/2008/Schedule
- 19:23, 7 March 2008 (hist) (diff) SEED/2008/Day 6
- 19:23, 7 March 2008 (hist) (diff) SEED/2008/Day 7
- 19:23, 7 March 2008 (hist) (diff) SEED/2008/Day 8
- 19:23, 7 March 2008 (hist) (diff) N SEED/2008/Day 9 (New page: == Morning == * start cultures from plates == Afternoon == * β-gal assay * data analysis)
- 19:22, 7 March 2008 (hist) (diff) SEED/2008/Day 4
- 19:22, 7 March 2008 (hist) (diff) SEED/2008/Day 5
- 19:19, 7 March 2008 (hist) (diff) SEED/2008/Day 3
- 19:15, 7 March 2008 (hist) (diff) SEED/2008/Schedule
- 19:11, 7 March 2008 (hist) (diff) SEED/2008/Links (top)
- 19:10, 7 March 2008 (hist) (diff) SEED/2008
- 17:16, 6 March 2008 (hist) (diff) Knight:Orders
- 19:42, 27 February 2008 (hist) (diff) Help:Chat
- 17:58, 27 February 2008 (hist) (diff) Help:Contents
- 17:57, 27 February 2008 (hist) (diff) N Help:Chat (New page: == Jabber/XMPP == OpenWetWare now runs a Jabber (XMPP) server. All OpenWetWare users automatically have an account and allows users to send messages to each other and also to have multi-u...)
- 12:46, 27 February 2008 (hist) (diff) UserPageDefaultContentText (top)
- 00:35, 27 February 2008 (hist) (diff) SEED/2008/Schedule
- 00:34, 27 February 2008 (hist) (diff) N SEED/2008/Overview (New page: == Objective == The goal of synthetic biology is to make it easier to engineer biological systems. One important engineering tool for simplifying the process of engineering complex system...) (top)
- 15:27, 26 February 2008 (hist) (diff) SEED/2008/Schedule
- 13:12, 26 February 2008 (hist) (diff) SEED/2008/Day 3
- 17:11, 25 February 2008 (hist) (diff) SEED/2008/Day 3
- 17:02, 25 February 2008 (hist) (diff) SEED/2008/Day 3
- 16:54, 25 February 2008 (hist) (diff) SEED/2008/Day 4
- 16:54, 25 February 2008 (hist) (diff) SEED/2008/Day 5
- 16:31, 25 February 2008 (hist) (diff) SEED/2008/Day 3
- 16:21, 25 February 2008 (hist) (diff) SEED/2008/Day 2 (top)
- 16:19, 25 February 2008 (hist) (diff) SEED/2008/Day 4
- 16:19, 25 February 2008 (hist) (diff) SEED/2008/Day 5
- 11:40, 25 February 2008 (hist) (diff) SEED/2008/Schedule
(Latest | Earliest) View (newer 250) (older 250) (20 | 50 | 100 | 250 | 500)
