Silver: PCR - Revision history

ChristinaAgapakis: /* Condition C: Phusion Polymerase */

ChristinaAgapakis — Mon, 07 Jun 2010 15:18:09 GMT

Condition C: Phusion Polymerase

←Older revision		Revision as of 15:18, 7 June 2010
Line 67:		Line 67:

	=== Condition C: Phusion Polymerase===		=== Condition C: Phusion Polymerase===
-	#Use [[http://www.neb.com/nebecomm/products/productf-530.asp \| NEB Phusion Polymerase Kit]]	+	#Use [http://www.neb.com/nebecomm/products/productf-530.asp NEB Phusion Polymerase Kit]
	#Mix:		#Mix:
	#* 10 µL Phusion Buffer		#* 10 µL Phusion Buffer

ChristinaAgapakis — Mon, 07 Jun 2010 15:17:53 GMT

Condition B: Pfx Polymerase

←Older revision		Revision as of 15:17, 7 June 2010
Line 66:		Line 66:


-	=== Condition C: Phusion Polymerase	+	=== Condition C: Phusion Polymerase===
	#Use [[http://www.neb.com/nebecomm/products/productf-530.asp \| NEB Phusion Polymerase Kit]]		#Use [[http://www.neb.com/nebecomm/products/productf-530.asp \| NEB Phusion Polymerase Kit]]
	#Mix:		#Mix:

ChristinaAgapakis — Mon, 07 Jun 2010 15:17:40 GMT

B. PCR from yeast chromosomal or plasmid template

←Older revision		Revision as of 15:17, 7 June 2010
Line 64:		Line 64:
	#*No. of Cycles: 35		#*No. of Cycles: 35
	#*End: keep at 4 °C forever		#*End: keep at 4 °C forever
		+
		+
		+	=== Condition C: Phusion Polymerase
		+	#Use [[http://www.neb.com/nebecomm/products/productf-530.asp \| NEB Phusion Polymerase Kit]]
		+	#Mix:
		+	#* 10 µL Phusion Buffer
		+	#* 1 µL 10mM dNTPs
		+	#* 2.5 µL Forward Primer (10 µM)
		+	#* 2.5 µL Reverse Primer (10 µM)
		+	#* 2 µL Genomic Template (less for plasmid template)
		+	#* 0.5 µL Phusion polymerase
		+	#* 31.5 µL Distilled Water (up to 50 µL)
		+	#PCR Program
		+	#*Start: 98 °C for 30 sec.
		+	#*Cycle: 98 °C for 10 sec.
		+	#*45-72 °C for 15 sec. (use 3 degrees above the primer Tm for annealing temperature)
		+	#*72 °C for 15-30 sec./kb
		+	#*No. of Cycles: 25-35
		+	#*72 °C for 5-10 min.
		+	#*End: 4 °C forever

	== C. Gel analysis and purification of PCR products ==		== C. Gel analysis and purification of PCR products ==

CarolineAjo-Franklin — Thu, 13 Dec 2007 22:33:48 GMT

←Older revision		Revision as of 22:33, 13 December 2007
Line 1:		Line 1:
	DESIGN & PREPARATION OF OLIGONUCLEOTIDE INSERTS FOR INSERTS ~ 85 BP AND LARGER: PRIMER AMPLIFICATION OF YEAST DNA		DESIGN & PREPARATION OF OLIGONUCLEOTIDE INSERTS FOR INSERTS ~ 85 BP AND LARGER: PRIMER AMPLIFICATION OF YEAST DNA
		+	*we need a new PCR machine!!

	== A. Primer design for PCR ==		== A. Primer design for PCR ==

DavidDrubin — Thu, 29 Nov 2007 20:01:09 GMT

A. Primer design for PCR

←Older revision		Revision as of 20:01, 29 November 2007
Line 2:		Line 2:

	== A. Primer design for PCR ==		== A. Primer design for PCR ==
-	*For typical BioBricks construction, you want a PCR product which has an XbaI site upstream of your part, and SpeI, NotI, and PstI sites downstream of your part. <br>Then, the forward primer should be of the form: <br>5' CCTTTCTAGA (15-20 bp ~~complement to~~ coding strand) 3' <br>and the reverse primer should be of the form: <br>5' AAGGCTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3'	+	*For typical BioBricks construction, you want a PCR product which has an XbaI site upstream of your part, and SpeI, NotI, and PstI sites downstream of your part. <br>Then, the forward primer should be of the form: <br>5' CCTTTCTAGA (15-20 bp of the coding strand) 3' <br>and the reverse primer should be of the form: <br>5' AAGGCTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3'
	*Design considerations. Make sure that:		*Design considerations. Make sure that:
	** The T<sub>m</sub> of each primer is between 55-65 °C		** The T<sub>m</sub> of each primer is between 55-65 °C

BrunoAfonso — Fri, 28 Sep 2007 01:33:15 GMT

Condition B: Pfx Polymerase

←Older revision		Revision as of 01:33, 28 September 2007
Line 47:		Line 47:
	#Use Stratagene's Pfx kit.		#Use Stratagene's Pfx kit.
	#Mix:		#Mix:
-	#* 3 µL primer mix (~~10mM~~ of each primer)	+	#* 3 µL primer mix (10µM of each primer)
	#* 0.8 µL template DNA		#* 0.8 µL template DNA
	#* 25 µL 10X PFx amplification buffer		#* 25 µL 10X PFx amplification buffer

BrunoAfonso — Wed, 18 Jul 2007 02:23:37 GMT

C. Gel analysis and purification of PCR products

←Older revision		Revision as of 02:23, 18 July 2007
Line 65:		Line 65:

	== C. Gel analysis and purification of PCR products ==		== C. Gel analysis and purification of PCR products ==
-	*Run ~~2 µL of~~ PCR reaction on an appropriate percentage agarose gel.	+	* Run the PCR reaction on an appropriate percentage agarose gel and purify using Qiagen's PCR purification kit. Elute with 30 µL or another volume depending on the band's brightness.
-	*If only your desired band is present, purify using Qiagen's PCR purification kit ~~and elute~~ with 30 µL.	+
-	*Else, gel extract.	+

	[[Category:Protocol]]		[[Category:Protocol]]
	[[Category:DNA]]		[[Category:DNA]]
	[[Category:In vitro]]		[[Category:In vitro]]

Jenny T Nguyen — Mon, 10 Jul 2006 18:51:28 GMT

←Older revision		Revision as of 18:51, 10 July 2006
Line 68:		Line 68:
	*If only your desired band is present, purify using Qiagen's PCR purification kit and elute with 30 µL.		*If only your desired band is present, purify using Qiagen's PCR purification kit and elute with 30 µL.
	*Else, gel extract.		*Else, gel extract.
		+
		+	[[Category:Protocol]]
		+	[[Category:DNA]]
		+	[[Category:In vitro]]

BrunoAfonso — Sat, 04 Mar 2006 01:27:22 GMT

Condition B: Pfx Polymerase

←Older revision		Revision as of 01:27, 4 March 2006
Line 47:		Line 47:
	#Use Stratagene's Pfx kit.		#Use Stratagene's Pfx kit.
	#Mix:		#Mix:
-	#* 3 µL primer mix	+	#* 3 µL primer mix (10mM of each primer)
	#* 0.8 µL template DNA		#* 0.8 µL template DNA
	#* 25 µL 10X PFx amplification buffer		#* 25 µL 10X PFx amplification buffer

CarolineAjo-Franklin — Wed, 22 Feb 2006 15:06:21 GMT

Condition B

←Older revision		Revision as of 15:06, 22 February 2006
Line 43:		Line 43:
	#*End: keep at 4 °C forever		#*End: keep at 4 °C forever

-	=== Condition B ===	+	=== Condition B: Pfx Polymerase ===
	#Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.		#Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
		+	#Use Stratagene's Pfx kit.
	#Mix:		#Mix:
	#* 3 µL primer mix		#* 3 µL primer mix