Sex genotyping of mice

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (05:50, 28 April 2011) (view source)
(test PCR)
 
(7 intermediate revisions not shown.)
Line 2: Line 2:
If the sex cannot be determined by inspection, a genotyping PCR for any region only found on the Y chromosome [http://tinyurl.com/65hwmtj] can be used.
If the sex cannot be determined by inspection, a genotyping PCR for any region only found on the Y chromosome [http://tinyurl.com/65hwmtj] can be used.
 +
 +
 +
== Common male-specific PCRs ==
 +
 +
==='''Sry''' Sex-determining region of the Y chromosome [http://www.ncbi.nlm.nih.gov/gene/21674] ===
 +
* forward SRY F :  TTG TCT AGA GAG CAT GGA GGG CCA TGT CAA
 +
* reverse SRY R :  CCA CTC CTC TGT GAC ACT TTA GCC CTC CGA
 +
* PCR product: 273 base pair
 +
: [http://mgc.wustl.edu/Protocols/PCRGenotypingPrimerPairs/tabid/154/Default.aspx Uni Washington, St. Louis, Mouse Genetics Core]
 +
 +
* forward sry1 AACAACTGGGCTTTGCACATTG
 +
* reverse sry2 GTTTATCAGGGTTTCTCTCTAGC
 +
* PCR product: 146/166 bp doublet
 +
: [http://www.mmrrc.org/strains/10318/di_protocol.pdf MMRRC's genotyping protocol including Sry primers]
 +
 +
 +
== Homologous pair SmcX/SmcY ==
 +
 +
* SMCX-1 5'-CCGCTGCCAAATTCTTTGG-3'
 +
* SMC4-1 5'-TGAAGCTTTTGGCTTTGAG-3'
 +
* PCR product: females single band, males 2 bands because of an intron difference between the X and Y genes (Agulnik 1997, PMID 9060413); adapted from [http://ko.cwru.edu/services/musfrming.html Case Western Transgenic Facility]
 +
 +
: X chromosomal SmcX = Kdm5c [http://www.ncbi.nlm.nih.gov/gene/20591]
 +
: Y chromosomal SmcY = Kdm5d [http://www.ncbi.nlm.nih.gov/gene/20592]
 +
 +
 +
== Test PCR with adult tail genomic samples ==
 +
 +
[[Image:Mouse sex genotyping.png|500px]]
 +
 +
'''Conditions''': Templates are known adult male and female tail gDNA samples. Standard PCR cycled using progressively lowered annealing temperature (65-58°C for first cycles, then 58°C); same conditions for all reactions. Primers as listed above. 12μL of a 25μL + 5μL Orange G run on a 2% agarose gel.
 +
 +
'''Interpretation''': The ''sry F/R'' pair worked best but does show weak unspecific products of similar size as the male-specific 273bp band. The sry 1/2 pair is probably also specific but bands are harder to recognise. For the SMC, we didn't observe the described doublet expected in males.
 +
 +
Keep in mind that this is a standard PCR. Amplification and specificity can probably be increased by optimisation of the PCR reaction.
 +
 +
 +
[[Category:Protocol]]
 +
[[Category:PCR]]
 +
[[Category:Mouse]]

Current revision

While adult mice can be readily sexed using anatomical features, young male and female mouse embryos are not yet sufficiently developed to assess their sex. In fact, their genital tubercles look superficially identical. At E16, only about 4 days before birth, the tubercle looks like this: E16 genital tubercles in Baskin's book, p. 108, figure 2.

If the sex cannot be determined by inspection, a genotyping PCR for any region only found on the Y chromosome [1] can be used.


Contents

Common male-specific PCRs

Sry Sex-determining region of the Y chromosome [2]

  • forward SRY F : TTG TCT AGA GAG CAT GGA GGG CCA TGT CAA
  • reverse SRY R : CCA CTC CTC TGT GAC ACT TTA GCC CTC CGA
  • PCR product: 273 base pair
Uni Washington, St. Louis, Mouse Genetics Core
  • forward sry1 AACAACTGGGCTTTGCACATTG
  • reverse sry2 GTTTATCAGGGTTTCTCTCTAGC
  • PCR product: 146/166 bp doublet
MMRRC's genotyping protocol including Sry primers


Homologous pair SmcX/SmcY

  • SMCX-1 5'-CCGCTGCCAAATTCTTTGG-3'
  • SMC4-1 5'-TGAAGCTTTTGGCTTTGAG-3'
  • PCR product: females single band, males 2 bands because of an intron difference between the X and Y genes (Agulnik 1997, PMID 9060413); adapted from Case Western Transgenic Facility
X chromosomal SmcX = Kdm5c [3]
Y chromosomal SmcY = Kdm5d [4]


Test PCR with adult tail genomic samples

Conditions: Templates are known adult male and female tail gDNA samples. Standard PCR cycled using progressively lowered annealing temperature (65-58°C for first cycles, then 58°C); same conditions for all reactions. Primers as listed above. 12μL of a 25μL + 5μL Orange G run on a 2% agarose gel.

Interpretation: The sry F/R pair worked best but does show weak unspecific products of similar size as the male-specific 273bp band. The sry 1/2 pair is probably also specific but bands are harder to recognise. For the SMC, we didn't observe the described doublet expected in males.

Keep in mind that this is a standard PCR. Amplification and specificity can probably be increased by optimisation of the PCR reaction.

Personal tools