Sacks:RAD-seq

From OpenWetWare

Revision as of 10:13, 24 September 2012 by Lindsay V. Clark (Talk | contribs)
Jump to: navigation, search

Contents

Overview

This is a protocol for generating RAD libraries for Illumina sequencing. With this technique, 96 samples can be multiplexed into one sequencing library, and only tags adjacent to PstI sites are sequenced. This is a cheap way to both mine and genotype large numbers of SNPs. This is the protocol developed in Erik Sacks' lab at UIUC by Lindsay Clark, based on protocols from Pat Brown and Megan Hall.

Materials

Reagents

  • Quant-iT Picogreen kit (Invitrogen)
  • Qiagen gel purification kit
  • Qiagen PCR cleanup kit
  • From New England Biolabs:
    • PstI-HF, 20,000 U/mL
    • MspI, 20,000 U/mL
    • T4 DNA ligase, 2,000,000 U/mL
    • ATP
    • Phusion High Fidelity PCR master mix

Note: MspI is not a heat-inactivated enzyme, but I have found that the protocol works anyway. Between the ligation and gel extraction steps, I keep the sample on ice to prevent any residual digestion activity.

Oligonucleotides

PstI adapters

This is the most expensive part of the protocol other than the sequencing itself, since 192 oligonucleotides must be ordered.

Adapter 1 top: 5'GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA3'

Adapter 1 bottom: 5'yyyyAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATC3'

Where xxxx and yyyy are the barcode and its reverse complement, respectively.

Barcodes and oligo sequences are from Pat Brown's lab.

Media:PstI-barcodes.txt

Other oligos

Equipment

  • Nanodrop spectrophotometer
  • BioTek Synergy plate reader (for reading fluorescence)
  • Ordinary PCR machine
  • Agarose gel rig
  • Bioanalyzer
  • real-time PCR machine (we just pay the core facility to do that part)

Procedure

Adapter prep

DNA quantification and dilution

Restriction digestion and ligation

Cleanup and amplification

Quality control

Bioinformatics

Notes

Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!

  1. List troubleshooting tips here.
  2. You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
  3. Anecdotal observations that might be of use to others can also be posted here.

Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.

References

  • Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K, Buckler ES, and Mitchell SE (2011) "A robust, simple Genotyping-by-Sequencing (GBS) approach for high diversity species." PLoS One 6(5): e19379. doi:10.1371/journal.pone.0019379

Contact

  • Who has experience with this protocol?

or instead, discuss this protocol.

Personal tools