SEED/2008/Day 4: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
Line 19: | Line 19: | ||
== Lecture == | == Lecture == | ||
* Review units | |||
** Volume (L) | |||
** Mass (g) | |||
** Moles (mol) | |||
** Molecular weight (Da) | |||
** Concentration | |||
*** % w/v (e.g. 1% agarose) | |||
*** % v/v (e.g. 70% ethanol) | |||
*** mass/volume (e.g. ng/ul) | |||
*** molarity (e.g. 1M NaCl) | |||
*** factors (e.g. 10x buffer) | |||
* Prefixes (milli, micro, nano, pico) | |||
* PCR discussion | * PCR discussion | ||
* What is Synthetic Biology? | * What is Synthetic Biology? | ||
Line 25: | Line 37: | ||
** General hierarchy (Parts, Devices, Systems) | ** General hierarchy (Parts, Devices, Systems) | ||
** Rational Design from Ground Up | ** Rational Design from Ground Up | ||
* Why should we care? | * Why should we care? | ||
** Project Ideas Homework Discussion | ** Project Ideas Homework Discussion |
Latest revision as of 09:51, 16 March 2008
Morning
- Set up 50ul PCRs with 2 different forward RBS primers
- 5ul 10x NovaTaq Buffer with MgCl2
- 1ul dNTP mix (10mM each dNTP)
- 1ul reverse primer (VR)
- 1ul RBS specific forward primer
- 0.25ul NovaTaq DNA polymerase
- 0.5ul DNA template of E0050 (10ng)
- rest PCR grade water
- Cycle 30 times
- 30s@94C
- 30s@55C
- 1m@72C
- Pour gel
Afternoon
- Run plasmid digest and PCRs on gel
- Cut out bands and save in freezer
Lecture
- Review units
- Volume (L)
- Mass (g)
- Moles (mol)
- Molecular weight (Da)
- Concentration
- % w/v (e.g. 1% agarose)
- % v/v (e.g. 70% ethanol)
- mass/volume (e.g. ng/ul)
- molarity (e.g. 1M NaCl)
- factors (e.g. 10x buffer)
- Prefixes (milli, micro, nano, pico)
- PCR discussion
- What is Synthetic Biology?
- Tie in Comic
- General, Very High Level Methods (Standardization, Abstraction, Encapsulation)
- General hierarchy (Parts, Devices, Systems)
- Rational Design from Ground Up
- Why should we care?
- Project Ideas Homework Discussion
- Environment, Energy, Medicine, Materials, Chemicals, Computing
- Understanding of Regulation, Function, Design (Minimal systems)
Instructor Preparation
- Oligos
- VR: attaccgcctttgagtgagc
- B0030.E0040-F: gaattctctagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttc
- B0031.E0040-F: gaattctctagagtcacacaggaaacctactagatgcgtaaaggagaagaacttttc
- B0032.E0040-F: gaattctctagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttc
- B0033.E0040-F: gaattctctagagtcacacaggactactagatgcgtaaaggagaagaacttttc
- B0034.E0040-F: gaattctctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc
- B0035.E0040-F: gaattctctagagattaaagaggagaatactagatgcgtaaaggagaagaacttttc
- Pairs of RBS primers to assign to groups (selected based on estimated strength):
- B0030 & B0032
- B0031 & B0035
- B0033 & B0034
- B0032 & B0033
- B0031 & B0034
- B0030 & B0035