SEED/2008/Day 3: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
Line 1: | Line 1: | ||
== Morning == | == Morning == | ||
* miniprep pSB4A5 cultures (x2) | * miniprep pSB4A5 cultures (x2) | ||
** Each group will do two minipreps | ** Each group will do two minipreps | ||
** elute in 30ul | |||
* spec miniprep concentrations (over lunch, instructor) | * spec miniprep concentrations (over lunch, instructor) | ||
Line 18: | Line 19: | ||
** 1m@72C | ** 1m@72C | ||
* Set up 50ul digest of pSB4A5 | * Set up one 50ul digest of pSB4A5 with EcoRI and PstI | ||
** 5ul NEB2 | ** 5ul NEB2 | ||
** 0.5ul BSA | ** 0.5ul BSA |
Revision as of 14:02, 25 February 2008
Morning
- miniprep pSB4A5 cultures (x2)
- Each group will do two minipreps
- elute in 30ul
- spec miniprep concentrations (over lunch, instructor)
Afternoon
- Set up 50ul PCRs with 2 different forward RBS primers
- 5ul 10x NovaTaq Buffer with MgCl2
- 1ul dNTP mix (10mM each dNTP)
- 1ul reverse primer (VR)
- 1ul RBS specific forward primer
- 0.25ul NovaTaq DNA polymerase
- 0.5ul DNA template of E0050 (10ng)
- rest PCR grade water
- Cycle 30 times
- 30s@94C
- 30s@55C
- 1m@72C
- Set up one 50ul digest of pSB4A5 with EcoRI and PstI
- 5ul NEB2
- 0.5ul BSA
- 2ug plasmid
- 1ul EcoRI
- 1ul PstI
Lecture
- PCR discussion
- What is Synthetic Biology?
- Tie in Comic
- General, Very High Level Methods (Standardization, Abstraction, Encapsulation)
- General hierarchy (Parts, Devices, Systems)
- Rational Design from Ground Up
- Who is involved?
- Scientists, Engineers, Students, Hobbyists, Politicians
- Why should we care?
- Project Ideas Homework Discussion
- Environment, Energy, Medicine, Materials, Chemicals, Computing
- Understanding of Regulation, Function, Design (Minimal systems)
- What are you going to learn and do in this class?
- Cloning Process Overview
- Characterization
Instructor Preparation
- miniprep 1A3.E0050 (PCR template)
- grow up cultures of pSB4A5.I52001 (destination vector)
- Oligos
- VR: attaccgcctttgagtgagc
- B0030.E0040-F: gaattctctagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttc
- B0031.E0040-F: gaattctctagagtcacacaggaaacctactagatgcgtaaaggagaagaacttttc
- B0032.E0040-F: gaattctctagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttc
- B0033.E0040-F: gaattctctagagtcacacaggactactagatgcgtaaaggagaagaacttttc
- B0034.E0040-F: gaattctctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc
- B0035.E0040-F: gaattctctagagattaaagaggagaatactagatgcgtaaaggagaagaacttttc
Instructor Post-prep
- store minipreps/PCRs in freezer