SBB13Ntbk-Ted Chavkin

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
__NOTOC__
__NOTOC__
-
[[User:Theodore A Chavkin|Theodore A Chavkin]] 13:08, 12 March 2013 (EDT)
+
[[User:Theodore A Chavkin|Theodore A Chavkin]] 10:08, 12 March 2013 (PST)
-
[[User:Theodore A Chavkin|Theodore A Chavkin]] 11:51, 5 March 2013 (EST)
+
Running Zymo Cleanup on PCA1
 +
<pre>
 +
Regular Zymo Cleanup
 +
The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.
 +
 
 +
Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.
 +
Transfer into the Zymo column (small clear guys)
 +
spin through, discard waste.
 +
Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
 +
spin through, discard waste.
 +
Add 200 uL of Zymo Wash Buffer
 +
spin through, discard waste.
 +
spin for 90 seconds, full speed to dry.
 +
elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
 +
</pre>
 +
 
 +
[[User:Theodore A Chavkin|Theodore A Chavkin]] 11:51, 5 March 2013 (PST)
<pre>
<pre>

Revision as of 13:11, 12 March 2013

Theodore A Chavkin 10:08, 12 March 2013 (PST) Running Zymo Cleanup on PCA1

Regular Zymo Cleanup
The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.

Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.
Transfer into the Zymo column (small clear guys)
spin through, discard waste.
Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
spin through, discard waste.
Add 200 uL of Zymo Wash Buffer
spin through, discard waste.
spin for 90 seconds, full speed to dry.
elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction

Theodore A Chavkin 11:51, 5 March 2013 (PST)


PCA1 quiC-2_oligo[1-16]			(471bp, pca1)
PCA2 quiC-2_oligo3/6 on pca1		(471bp, quiC2)
Digest quiC2					(EcoRI/BamHI, 426+26+19bp, L, quiC2dig)
Digest pBca9145-Bca114#5			(EcoRI/BamHI, 2057+910bp, L, vectdig)
Ligate quiC2dig + vectdig			(pTC001)

>quiC2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAATACGGAACAAACGTTAGAACTATGACCTTGCCAGGTTTAGTCTTGCAAGATGTTAATGGTGTTACTTTGAAGGGATTAGACGTTCATAGGTTCTGTATAGGAGTCTTAGTTAACAGATCATCTAACAATTTAATTCAACACAATAGAATATCAAACAATTACGGAGGTGCCGGTGTCATGATTACTGGTGATGATGGTAAAGGTAACCCAACTTCTACCACAACTAACAACAATAAAGTCTTAGATAATGTCTTTATTGATAATGGTGATGGTTTAGAGTTAACTAGAGGTGCTGCTTTTAATTTAATTGCTAATAATTTATTCACATCAACTAAGGCTAATCCTGAACCATCACAAGGTATCGAAATTTTGTGGGGTAACGATAATGTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
>pTC001
AGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTGCATCGTCTCAATACGGAACAAACGTTAGAACTATGACCTTGCCAGGTTTAGTCTTGCAAGATGTTAATGGTGTTACTTTGAAGGGATTAGACGTTCATAGGTTCTGTATAGGAGTCTTAGTTAACAGATCATCTAACAATTTAATTCAACACAATAGAATATCAAACAATTACGGAGGTGCCGGTGTCATGATTACTGGTGATGATGGTAAAGGTAACCCAACTTCTACCACAACTAACAACAATAAAGTCTTAGATAATGTCTTTATTGATAATGGTGATGGTTTAGAGTTAACTAGAGGTGCTGCTTTTAATTTAATTGCTAATAATTTATTCACATCAACTAAGGCTAATCCTGAACCATCACAAGGTATCGAAATTTTGTGGGGTAACGATAATGTGAGACGGCATGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAAT

Protocol:
1.	38 uL ddH2O
2.	5 ul 10x expand buffer
3.	5 ul 2mM dNTPs
4.	1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
5.	0.75 ul Expand polymerase
Program:
1.	2 min initial denature at 94oC
2.	30 sec denature at 94oC
3.	30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed]
4.	30 sec extension at 72oC
5.	repeat 2-4 30 times total

Personal tools