SBB13Ntbk-Ted Chavkin

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
__NOTOC__
__NOTOC__
 +
[[User:Theodore A Chavkin|Theodore A Chavkin]]
[[User:Theodore A Chavkin|Theodore A Chavkin]] 11:51, 5 March 2013 (EST)
[[User:Theodore A Chavkin|Theodore A Chavkin]] 11:51, 5 March 2013 (EST)
<pre>
<pre>

Revision as of 13:08, 12 March 2013

Theodore A Chavkin Theodore A Chavkin 11:51, 5 March 2013 (EST)


PCA1 quiC-2_oligo[1-16]			(471bp, pca1)
PCA2 quiC-2_oligo3/6 on pca1		(471bp, quiC2)
Digest quiC2					(EcoRI/BamHI, 426+26+19bp, L, quiC2dig)
Digest pBca9145-Bca114#5			(EcoRI/BamHI, 2057+910bp, L, vectdig)
Ligate quiC2dig + vectdig			(pTC001)

>quiC2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAATACGGAACAAACGTTAGAACTATGACCTTGCCAGGTTTAGTCTTGCAAGATGTTAATGGTGTTACTTTGAAGGGATTAGACGTTCATAGGTTCTGTATAGGAGTCTTAGTTAACAGATCATCTAACAATTTAATTCAACACAATAGAATATCAAACAATTACGGAGGTGCCGGTGTCATGATTACTGGTGATGATGGTAAAGGTAACCCAACTTCTACCACAACTAACAACAATAAAGTCTTAGATAATGTCTTTATTGATAATGGTGATGGTTTAGAGTTAACTAGAGGTGCTGCTTTTAATTTAATTGCTAATAATTTATTCACATCAACTAAGGCTAATCCTGAACCATCACAAGGTATCGAAATTTTGTGGGGTAACGATAATGTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
>pTC001
AGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTGCATCGTCTCAATACGGAACAAACGTTAGAACTATGACCTTGCCAGGTTTAGTCTTGCAAGATGTTAATGGTGTTACTTTGAAGGGATTAGACGTTCATAGGTTCTGTATAGGAGTCTTAGTTAACAGATCATCTAACAATTTAATTCAACACAATAGAATATCAAACAATTACGGAGGTGCCGGTGTCATGATTACTGGTGATGATGGTAAAGGTAACCCAACTTCTACCACAACTAACAACAATAAAGTCTTAGATAATGTCTTTATTGATAATGGTGATGGTTTAGAGTTAACTAGAGGTGCTGCTTTTAATTTAATTGCTAATAATTTATTCACATCAACTAAGGCTAATCCTGAACCATCACAAGGTATCGAAATTTTGTGGGGTAACGATAATGTGAGACGGCATGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAAT

Protocol:
1.	38 uL ddH2O
2.	5 ul 10x expand buffer
3.	5 ul 2mM dNTPs
4.	1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
5.	0.75 ul Expand polymerase
Program:
1.	2 min initial denature at 94oC
2.	30 sec denature at 94oC
3.	30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed]
4.	30 sec extension at 72oC
5.	repeat 2-4 30 times total

Personal tools