SBB13Ntbk-Tai Lun Ng

From OpenWetWare

Revision as of 12:52, 18 April 2013 by Tai Lun Ng (Talk | contribs)
Jump to: navigation, search

Contents

April 18, 2013

Goal for Today: Transform the assembled product into cells


April 16, 2013

Goal for Today: Check Sequencing. If correct: Golden Gate all the synthons together
1. Compare predicted PCR product with the sequence files




April 11, 2013

RESULTS: cultures grew
Goal for Today:Miniprep cultures, restriction map with ECORI/XhoI, Run on a gel, submit to sequencing
1. Miniprep cultures http://openwetware.org/wiki/Template:SBB-Protocols_Micro3
2. Test Digest with ECORI and XhoI http://openwetware.org/wiki/Template:SBB-Protocols_Enz6
3. Run the gel
4.

April 9, 2013

RESULTS: There are colonies this time!
Goal for Today:Pick colonies and start cultures

April 4, 2013

Goal for Today: Ligate pcrpdt digest with vector digest, transform into MC1061 cells via heat shock, plate the cells</br> 1. Instructor performed PCA and digested the pcrdpt with ECORI and BAMHI
2. Perform a ligation reaction (http://openwetware.org/wiki/Template:SBB-Protocols_Enz4)
3. Transform into MC1061 cells (http://openwetware.org/wiki/Template:SBB-Protocols_Micro1)
NOTE: no ddH2O. Just 1 tube cells with 30uL KCM
4. Plate the cells on ampicillin plates

April 2, 2013

RESULT from March 21, 2013: Very little colonies on plate. Systematic Error in class?
Goal for Today:Run digested PCRpdt on the gel to see if we have any DNA material 1. Mixed 0.5uL of 6x loading dye with 2 uL of pcrdigest
2. Ran the gel
3. Result: There is an apparent band. Can proceed to transformation on Thursday

March 21, 2013

Goal for Today: Ligate pcrpdt digest with vector digest, transform into MC1061 cells via heat shock, plate the cells
1. Instructor performed PCA and digested the pcrdpt with ECORI and BAMHI
2. Perform a ligation reaction (http://openwetware.org/wiki/Template:SBB-Protocols_Enz4)
3. Transform into MC1061 cells (http://openwetware.org/wiki/Template:SBB-Protocols_Micro1)
4. Plate the cells on ampicillin plates

March 19, 2013

Goal for TODAY: Zymo cleanup PCA2 pcrpdt from March 15, 2013 and test digest with ECORI and BAMHI
1. Pick up PCA pcrpdt of FCCOMT-2
2. Test digest pcrpdt with ECORI and BAMHI http://openwetware.org/wiki/Template:SBB-Protocols_Enz2
3. loaded the digpdt in 1% agarose gel
4. Run the gel at 170V for 20 minutes.
RESULT: no band appeared

March 14, 2013

RESULT from March 12, 2013: PCR band for FCCOMT-2 did not appear strongly (lane 8).

Goal for Today: Load the minute pcrpdt, gel purify it out, reamplify with external oligo
1. Added 10 uL of PCR product and 2uL of dye into 1% agarose gel
2. Run on gel at 120V for 20 minutes
3. A band appeared. Gel cut out
5. Zymo gel purify with the kit. (http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3) 6. Run PCA2 with FaCCOMT-2_oligo_12 to FaCCOMT-2_oligo_14 (http://openwetware.org/wiki/Template:SBB-PCA)
7. GSI ran the thermocycler

March 12, 2013

Goal for Today: Set up PCA 2 reaction 1. Pick up the pcrpdt
2. Run the PCA2 reaction with external olgios FCCOMT-12 and FCCOMT-14 http://openwetware.org/wiki/Template:SBB-PCA
3. GSI ran the thermocycler.

March 8, 2013

Goal for Today: Set up PCA1 reaction
1. Followed the protocol for PCA1 reaction. (http://openwetware.org/wiki/Template:SBB-PCA)
2. GSI ran the thermocycler

March 5, 2013

Construction File for PCA assembly of FaCCOMT-2

1. Make a 100uM 1 ul oligo mixture of FaCCOMT-2_oligo_1 to FaCCOMT-2_oligo_16
2. PCA FaCCOMT-2_oligo_1 to FaCCOMT-2_oligo_16 {pca1, 465 bp}
3. Zymo cleanup
4. PCA2 pca1 with FaCCOMT-2_oligo_12 to FaCCOMT-2_oligo_14 {pcrpdt, 465 bp}
5. Zymo cleanup the amplification reactions
6. Digest the product with EcoRI/BAMHI {pcrdig,420bp + 20 + 25, L}
7. Digest PBCA1945 with ECORI/BAMHI {vectdig,696+2057 bp, L}
8. Ligate pcrdig + vectdig {Pca9145-FaCCOMT-2, 2477 bp}

pcrpdt ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAGATGGTGTTTCTATCGCAGCATTGTGCTTAATGAACCAAGATAAGGTCTTAGTCGAGTCATGGTATCATTTGAAAGATGCTGTTTTGGACGGTGGTATTCCTTTTAATAAGGCATACGGAATGACAGCCTTCGATTACCATGGTACTGATCCAAGATTTAATAAAGTTTTCAACAAAGGAATGGCTGACCACTCTACTATTACAATGAAGAAAATCTTGGAAACTTACAAGGGTTTCGAGGGTTTAAAATCAATAGTAGACGTAGGTGGTGGAACTGGTGCTGTTGTTAATATGATTGTATCTAAATATCCTTCAATTAAGGGTATAAATTTCGACTTACCTCATGTAATTGAGGATGCTCCACAATACCCAGGTGTCCAGCATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT (465bp)

Pca9145-FaCCOMT-2 gAATTCATGAGATCTGCATCGTCTCAGATGGTGTTTCTATCGCAGCATTGTGCTTAATGAACCAAGATAAGGTCTTAGTCGAGTCATGGTATCATTTGAAAGATGCTGTTTTGGACGGTGGTATTCCTTTTAATAAGGCATACGGAATGACAGCCTTCGATTACCATGGTACTGATCCAAGATTTAATAAAGTTTTCAACAAAGGAATGGCTGACCACTCTACTATTACAATGAAGAAAATCTTGGAAACTTACAAGGGTTTCGAGGGTTTAAAATCAATAGTAGACGTAGGTGGTGGAACTGGTGCTGTTGTTAATATGATTGTATCTAAATATCCTTCAATTAAGGGTATAAATTTCGACTTACCTCATGTAATTGAGGATGCTCCACAATACCCAGGTGTCCAGCATGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg

Personal tools