SBB13Ntbk-Tai Lun Ng: Difference between revisions
Tai Lun Ng (talk | contribs) |
Tai Lun Ng (talk | contribs) No edit summary |
||
| (15 intermediate revisions by the same user not shown) | |||
| Line 1: | Line 1: | ||
== May 2, 2013 == | |||
'''Goal for Today: mapping the pG001-Faccomt vector with BsaI'''<br/><br/> | |||
1. Map the 6 candidates with BsaI<br/> | |||
7 uL ddH2O<br/> | |||
2uL Miniprepped plasmid<br/> | |||
1uL 10x NEB Buffer 2<br/> | |||
0.5uL BsaI<br/> | |||
2. Ran on the gel<br/> | |||
3. None of the plasmids gave the right band sizes<br/> | |||
== April 30, 2013 == | |||
'''Goal for Today: mapping the pG001-Faccomt vector with BsaI'''<br/><br/> | |||
1. Map the 6 candidates with BsaI<br/> | |||
8 uL ddH2O<br/> | |||
1uL Miniprepped plasmid<br/> | |||
1uL 10x NEB Buffer 2<br/> | |||
0.5uL BsaI<br/> | |||
2. Ran on the gel<br/> | |||
3. Inconclusive since the bands were very faint. Redo on Thursday<br/> | |||
== April 28, 2013 (@ EBB) == | |||
'''Goal for Today: Minprep the colonies'''<br/><br/> | |||
1. miniprep pGG001-Faccomt vectors | |||
== April 27, 2013 (@ EBB) == | |||
RESULTS: "6 white colonies on the plate" | |||
'''Goal for Today: Picked the colonies and grew them in LB + CM'''<br/><br/> | |||
1. Picked the white colonies with pipette tip<br/> | |||
2. Dipped them in LB+CM and grew them in 37C for 1 hours<br/> | |||
== April 26, 2013 (@ EBB) == | |||
'''Goal for Today: Ligate the synthons and vector digest and do the Transformation'''<br/><br/> | |||
1. Ligate the synthons and vector digests with Quick Ligase in Quick Ligase Buffer <br/> | |||
2. Let it sit in room temperature for 4 hours<br/> | |||
3. Transformed into Top 10 Cells<br/> | |||
4. Plated on CM plates<br/> | |||
5. incubate at 37C<br/> | |||
== April 25, 2013 == | |||
RESULTS: "None of the picked colonies for our Faccomt gene contain the plasmid. We decided to do the Golden Gate reaction in 2 separate pot: Digest with BsmBI, Purify on Gel, mix them together and ligate them, then transform again" | |||
'''Goal for Today: Digest the synthons with BsmBI and run on Gel'''<br/><br/> | |||
1. Digest with synthons with BsmBI<br/> | |||
1uL NEB buffer 3<br/> | |||
1uL per construct<br/> | |||
0.5uL BsmB1<br/> | |||
5.5uL ddH2O<br/> | |||
Then, incubate in thermocycler at 55°C for 1 hour.<br/><br/> | |||
2. Run on Gel | |||
3. cut out the fragments<br/> | |||
4. Zymo clean up | |||
== April 23, 2013 == | |||
'''Goal for Today: Transform Golden Gate Assembly into competent cells'''<br/><br/> | |||
Transformation by Heat-Shock<br/> | |||
1. Thaw a 200 uL aliquot of cells on ice.<br/> | |||
2. Add 20 uL of KCM to the cells.<br/> | |||
3. Put your ligation mixture on ice, let cool a minute or two.<br/> | |||
4. Add 70 uL of the cell cocktail to the ligation, stir to mix<br/> | |||
5. Let sit on ice for 10 min.<br/> | |||
6. Heat shock for 90 seconds at 42°C.<br/> | |||
7. Put back on ice for 1 min.<br/> | |||
8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour.<br/> | |||
9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight.<br/><br/> | |||
GSI will incubate the plates and pick colonies and scale up for us<br/> | |||
== April 19, 2013 == | |||
RESULTS: "None of the Golden Gate reactions wroked as we did not have colonies. " <br/> | |||
'''Goal for Today: Redo Golden Gate Assembly with new protocol<br/><br/>''' | |||
4.5uL ddH2O<br/> | |||
1uL Ligase buffer<br/> | |||
0.5uL Ligase<br/> | |||
0.5uL BsmB1<br/> | |||
1uL '''TOTAL''' construct mix<br/> | |||
0.5uL Vector<br/> <br/> | |||
GSI will continue the ligation for us <br/> | |||
== April 18, 2013 == | |||
'''Goal for Today: Transform the assembled product into cells''' | |||
1. The plasmids with the tentative Faccomt gene are heatshocked into competent cells <br/> | |||
2. The protocol is as follow<br/><br/> | |||
1. Thaw a 200 uL aliquot of cells on ice.<br/> | |||
2. Add 20 uL of KCM to the cells.<br/> | |||
3. Put your ligation mixture on ice, let cool a minute or two.<br/> | |||
4. Add 70 uL of the cell cocktail to the ligation, stir to mix<br/> | |||
5. Let sit on ice for 10 min.<br/> | |||
6. Heat shock for 90 seconds at 42°C.<br/> | |||
7. Put back on ice for 1 min.<br/> | |||
8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour.<br/> | |||
9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight.<br/><br/> | |||
3. GSI will grow the culture on the plate <br/> | |||
== April 16, 2013 == | |||
'''Goal for Today: Check Sequencing. If correct: Golden Gate all the synthons together''' <br/> | |||
1. Compare predicted PCR product with the sequence files<br/> | |||
2. FaCCOMT2A and FaCComt 3A sequences look correct.<br/> | |||
3. See Young have correct synthon part for FaCCOMT 1A<br/> | |||
4,. Set up the Golden Gate Reaction.<br/><br/> | |||
4.5uL ddH2O<br/> | |||
1uL Ligase buffer<br/> | |||
0.5uL Ligase | |||
0.5uL BsmB1<br/> | |||
1uL per construct<br/> | |||
0.5uL Vector<br/><br/> | |||
5. GSI will continue the 4 hour ligation for us.<br/> | |||
== April 11, 2013 == | |||
RESULTS: cultures grew<br/> | |||
'''Goal for Today:Miniprep cultures, restriction map with ECORI/XhoI, Run on a gel, submit to sequencing'''<br/> | |||
1. Miniprep cultures http://openwetware.org/wiki/Template:SBB-Protocols_Micro3 <br/> | |||
2. Test Digest with ECORI and XhoI http://openwetware.org/wiki/Template:SBB-Protocols_Enz6 <br/> | |||
3. Run the gel <br/> | |||
4. All the synthon candidate parts looked correct: submitted them for sequencing!<br/> | |||
== April 9, 2013 == | == April 9, 2013 == | ||
RESULTS: There are colonies this time!<br/> | RESULTS: There are colonies this time!<br/> | ||
'''Goal for Today:Pick colonies | '''Goal for Today:Pick colonies and start cultures'''<br/> | ||
1. Used pipette tip to pick colonies from the plates<br/> | |||
2. Dipped it into media with selection antibiotic <br/> | |||
3. GSI and instructor grew them for us<br/> | |||
== April 4, 2013 == | == April 4, 2013 == | ||
Latest revision as of 12:12, 11 May 2013
May 2, 2013
Goal for Today: mapping the pG001-Faccomt vector with BsaI
1. Map the 6 candidates with BsaI
7 uL ddH2O
2uL Miniprepped plasmid
1uL 10x NEB Buffer 2
0.5uL BsaI
2. Ran on the gel
3. None of the plasmids gave the right band sizes
April 30, 2013
Goal for Today: mapping the pG001-Faccomt vector with BsaI
1. Map the 6 candidates with BsaI
8 uL ddH2O
1uL Miniprepped plasmid
1uL 10x NEB Buffer 2
0.5uL BsaI
2. Ran on the gel
3. Inconclusive since the bands were very faint. Redo on Thursday
April 28, 2013 (@ EBB)
Goal for Today: Minprep the colonies
1. miniprep pGG001-Faccomt vectors
April 27, 2013 (@ EBB)
RESULTS: "6 white colonies on the plate"
Goal for Today: Picked the colonies and grew them in LB + CM
1. Picked the white colonies with pipette tip
2. Dipped them in LB+CM and grew them in 37C for 1 hours
April 26, 2013 (@ EBB)
Goal for Today: Ligate the synthons and vector digest and do the Transformation
1. Ligate the synthons and vector digests with Quick Ligase in Quick Ligase Buffer
2. Let it sit in room temperature for 4 hours
3. Transformed into Top 10 Cells
4. Plated on CM plates
5. incubate at 37C
April 25, 2013
RESULTS: "None of the picked colonies for our Faccomt gene contain the plasmid. We decided to do the Golden Gate reaction in 2 separate pot: Digest with BsmBI, Purify on Gel, mix them together and ligate them, then transform again"
Goal for Today: Digest the synthons with BsmBI and run on Gel
1. Digest with synthons with BsmBI
1uL NEB buffer 3
1uL per construct
0.5uL BsmB1
5.5uL ddH2O
Then, incubate in thermocycler at 55°C for 1 hour.
2. Run on Gel
3. cut out the fragments
4. Zymo clean up
April 23, 2013
Goal for Today: Transform Golden Gate Assembly into competent cells
Transformation by Heat-Shock
1. Thaw a 200 uL aliquot of cells on ice.
2. Add 20 uL of KCM to the cells.
3. Put your ligation mixture on ice, let cool a minute or two.
4. Add 70 uL of the cell cocktail to the ligation, stir to mix
5. Let sit on ice for 10 min.
6. Heat shock for 90 seconds at 42°C.
7. Put back on ice for 1 min.
8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour.
9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight.
GSI will incubate the plates and pick colonies and scale up for us
April 19, 2013
RESULTS: "None of the Golden Gate reactions wroked as we did not have colonies. "
Goal for Today: Redo Golden Gate Assembly with new protocol
4.5uL ddH2O
1uL Ligase buffer
0.5uL Ligase
0.5uL BsmB1
1uL TOTAL construct mix
0.5uL Vector
GSI will continue the ligation for us
April 18, 2013
Goal for Today: Transform the assembled product into cells
1. The plasmids with the tentative Faccomt gene are heatshocked into competent cells
2. The protocol is as follow
1. Thaw a 200 uL aliquot of cells on ice.
2. Add 20 uL of KCM to the cells.
3. Put your ligation mixture on ice, let cool a minute or two.
4. Add 70 uL of the cell cocktail to the ligation, stir to mix
5. Let sit on ice for 10 min.
6. Heat shock for 90 seconds at 42°C.
7. Put back on ice for 1 min.
8. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour.
9. Plate 70+ uL on selective antibiotics, let incubate at 37°C overnight.
3. GSI will grow the culture on the plate
April 16, 2013
Goal for Today: Check Sequencing. If correct: Golden Gate all the synthons together
1. Compare predicted PCR product with the sequence files
2. FaCCOMT2A and FaCComt 3A sequences look correct.
3. See Young have correct synthon part for FaCCOMT 1A
4,. Set up the Golden Gate Reaction.
4.5uL ddH2O
1uL Ligase buffer
0.5uL Ligase
0.5uL BsmB1
1uL per construct
0.5uL Vector
5. GSI will continue the 4 hour ligation for us.
April 11, 2013
RESULTS: cultures grew
Goal for Today:Miniprep cultures, restriction map with ECORI/XhoI, Run on a gel, submit to sequencing
1. Miniprep cultures http://openwetware.org/wiki/Template:SBB-Protocols_Micro3
2. Test Digest with ECORI and XhoI http://openwetware.org/wiki/Template:SBB-Protocols_Enz6
3. Run the gel
4. All the synthon candidate parts looked correct: submitted them for sequencing!
April 9, 2013
RESULTS: There are colonies this time!
Goal for Today:Pick colonies and start cultures
1. Used pipette tip to pick colonies from the plates
2. Dipped it into media with selection antibiotic
3. GSI and instructor grew them for us
April 4, 2013
Goal for Today: Ligate pcrpdt digest with vector digest, transform into MC1061 cells via heat shock, plate the cells
1. Instructor performed PCA and digested the pcrdpt with ECORI and BAMHI
2. Perform a ligation reaction (http://openwetware.org/wiki/Template:SBB-Protocols_Enz4)
3. Transform into MC1061 cells (http://openwetware.org/wiki/Template:SBB-Protocols_Micro1)
NOTE: no ddH2O. Just 1 tube cells with 30uL KCM
4. Plate the cells on ampicillin plates
April 2, 2013
RESULT from March 21, 2013: Very little colonies on plate. Systematic Error in class?
Goal for Today:Run digested PCRpdt on the gel to see if we have any DNA material
1. Mixed 0.5uL of 6x loading dye with 2 uL of pcrdigest
2. Ran the gel
3. Result: There is an apparent band. Can proceed to transformation on Thursday
March 21, 2013
Goal for Today: Ligate pcrpdt digest with vector digest, transform into MC1061 cells via heat shock, plate the cells
1. Instructor performed PCA and digested the pcrdpt with ECORI and BAMHI
2. Perform a ligation reaction (http://openwetware.org/wiki/Template:SBB-Protocols_Enz4)
3. Transform into MC1061 cells (http://openwetware.org/wiki/Template:SBB-Protocols_Micro1)
4. Plate the cells on ampicillin plates
March 19, 2013
Goal for TODAY: Zymo cleanup PCA2 pcrpdt from March 15, 2013 and test digest with ECORI and BAMHI
1. Pick up PCA pcrpdt of FCCOMT-2
2. Test digest pcrpdt with ECORI and BAMHI http://openwetware.org/wiki/Template:SBB-Protocols_Enz2
3. loaded the digpdt in 1% agarose gel
4. Run the gel at 170V for 20 minutes.
RESULT: no band appeared
March 14, 2013
RESULT from March 12, 2013: PCR band for FCCOMT-2 did not appear strongly (lane 8).
Goal for Today: Load the minute pcrpdt, gel purify it out, reamplify with external oligo
1. Added 10 uL of PCR product and 2uL of dye into 1% agarose gel
2. Run on gel at 120V for 20 minutes
3. A band appeared. Gel cut out
5. Zymo gel purify with the kit. (http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3)
6. Run PCA2 with FaCCOMT-2_oligo_12 to FaCCOMT-2_oligo_14 (http://openwetware.org/wiki/Template:SBB-PCA)
7. GSI ran the thermocycler
March 12, 2013
Goal for Today: Set up PCA 2 reaction
1. Pick up the pcrpdt
2. Run the PCA2 reaction with external olgios FCCOMT-12 and FCCOMT-14 http://openwetware.org/wiki/Template:SBB-PCA
3. GSI ran the thermocycler.
March 8, 2013
Goal for Today: Set up PCA1 reaction
1. Followed the protocol for PCA1 reaction. (http://openwetware.org/wiki/Template:SBB-PCA)
2. GSI ran the thermocycler
March 5, 2013
Construction File for PCA assembly of FaCCOMT-2
1. Make a 100uM 1 ul oligo mixture of FaCCOMT-2_oligo_1 to FaCCOMT-2_oligo_16
2. PCA FaCCOMT-2_oligo_1 to FaCCOMT-2_oligo_16 {pca1, 465 bp}
3. Zymo cleanup
4. PCA2 pca1 with FaCCOMT-2_oligo_12 to FaCCOMT-2_oligo_14 {pcrpdt, 465 bp}
5. Zymo cleanup the amplification reactions
6. Digest the product with EcoRI/BAMHI {pcrdig,420bp + 20 + 25, L}
7. Digest PBCA1945 with ECORI/BAMHI {vectdig,696+2057 bp, L}
8. Ligate pcrdig + vectdig {Pca9145-FaCCOMT-2, 2477 bp}
pcrpdt
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAGATGGTGTTTCTATCGCAGCATTGTGCTTAATGAACCAAGATAAGGTCTTAGTCGAGTCATGGTATCATTTGAAAGATGCTGTTTTGGACGGTGGTATTCCTTTTAATAAGGCATACGGAATGACAGCCTTCGATTACCATGGTACTGATCCAAGATTTAATAAAGTTTTCAACAAAGGAATGGCTGACCACTCTACTATTACAATGAAGAAAATCTTGGAAACTTACAAGGGTTTCGAGGGTTTAAAATCAATAGTAGACGTAGGTGGTGGAACTGGTGCTGTTGTTAATATGATTGTATCTAAATATCCTTCAATTAAGGGTATAAATTTCGACTTACCTCATGTAATTGAGGATGCTCCACAATACCCAGGTGTCCAGCATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT (465bp)
Pca9145-FaCCOMT-2 gAATTCATGAGATCTGCATCGTCTCAGATGGTGTTTCTATCGCAGCATTGTGCTTAATGAACCAAGATAAGGTCTTAGTCGAGTCATGGTATCATTTGAAAGATGCTGTTTTGGACGGTGGTATTCCTTTTAATAAGGCATACGGAATGACAGCCTTCGATTACCATGGTACTGATCCAAGATTTAATAAAGTTTTCAACAAAGGAATGGCTGACCACTCTACTATTACAATGAAGAAAATCTTGGAAACTTACAAGGGTTTCGAGGGTTTAAAATCAATAGTAGACGTAGGTGGTGGAACTGGTGCTGTTGTTAATATGATTGTATCTAAATATCCTTCAATTAAGGGTATAAATTTCGACTTACCTCATGTAATTGAGGATGCTCCACAATACCCAGGTGTCCAGCATGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg
