SBB13Ntbk-Tai Lun Ng: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 5: Line 5:


1. Make a 100uM 1 ul oligo mixture of FaCCOMT-2_oligo_1 to FaCCOMT-2_oligo_16 <br/>
1. Make a 100uM 1 ul oligo mixture of FaCCOMT-2_oligo_1 to FaCCOMT-2_oligo_16 <br/>
2. Set up the PCA reaction by mixing: <br/>
2. Set up the PCA reaction by mixing: <br/><br/>
38 uL ddH2O<br/>
38 uL ddH2O<br/>
5 ul 10x expand buffer<br/>
5 ul 10x expand buffer<br/>
5 ul 2mM dNTPs<br/>
5 ul 2mM dNTPs<br/>
1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)<br/>
1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)<br/>
0.75 ul Expand polymerase<br/>
0.75 ul Expand polymerase<br/><br/>
3.
3.Run on the PCR machine this program:<br/>br/>
Program (can run JCA/PCA1)<br/>
2 min initial denature at 94oC<br/>
30 sec denature at 94oC<br/>
30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed]<br/>
30 sec extension at 72oC<br/>
repeat 2-4 30 times total<br/><br/>
4. The expected product is :<br/>
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAGATGGTGTTTCTATCGCAGCATTGTGCTTAATGAACCAAGATAAGGTCTTAGTCGAGTCATGGTATCATTTGAAAGATGCTGTTTTGGACGGTGGTATTCCTTTTAATAAGGCATACGGAATGACAGCCTTCGATTACCATGGTACTGATCCAAGATTTAATAAAGTTTTCAACAAAGGAATGGCTGACCACTCTACTATTACAATGAAGAAAATCTTGGAAACTTACAAGGGTTTCGAGGGTTTAAAATCAATAGTAGACGTAGGTGGTGGAACTGGTGCTGTTGTTAATATGATTGTATCTAAATATCCTTCAATTAAGGGTATAAATTTCGACTTACCTCATGTAATTGAGGATGCTCCACAATACCCAGGTGTCCAGCATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT (465bp)<br/><br/>
5. Run a zymo cleanup:
Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.<br/>
Transfer into the Zymo column (small clear guys)<br/>
spin through, discard waste.<br/>
Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)<br/>
spin through, discard waste.<br/>
Add 200 uL of Zymo Wash Buffer<br/>
spin through, discard waste.<br/>
spin for 90 seconds, full speed to dry.<br/>
elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction<br/><br/>
6. Set up another PCR reaction with FaCCOMT-2_oligo_12 and FaCCOMT-2_oligo_14.

Revision as of 13:15, 5 March 2013

March 5, 2013

Construction File for PCA assembly of FaCCOMT-2

1. Make a 100uM 1 ul oligo mixture of FaCCOMT-2_oligo_1 to FaCCOMT-2_oligo_16
2. Set up the PCA reaction by mixing:

38 uL ddH2O
5 ul 10x expand buffer
5 ul 2mM dNTPs
1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
0.75 ul Expand polymerase

3.Run on the PCR machine this program:
br/> Program (can run JCA/PCA1)
2 min initial denature at 94oC
30 sec denature at 94oC
30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed]
30 sec extension at 72oC
repeat 2-4 30 times total

4. The expected product is :
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAGATGGTGTTTCTATCGCAGCATTGTGCTTAATGAACCAAGATAAGGTCTTAGTCGAGTCATGGTATCATTTGAAAGATGCTGTTTTGGACGGTGGTATTCCTTTTAATAAGGCATACGGAATGACAGCCTTCGATTACCATGGTACTGATCCAAGATTTAATAAAGTTTTCAACAAAGGAATGGCTGACCACTCTACTATTACAATGAAGAAAATCTTGGAAACTTACAAGGGTTTCGAGGGTTTAAAATCAATAGTAGACGTAGGTGGTGGAACTGGTGCTGTTGTTAATATGATTGTATCTAAATATCCTTCAATTAAGGGTATAAATTTCGACTTACCTCATGTAATTGAGGATGCTCCACAATACCCAGGTGTCCAGCATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT (465bp)

5. Run a zymo cleanup: Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.
Transfer into the Zymo column (small clear guys)
spin through, discard waste.
Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
spin through, discard waste.
Add 200 uL of Zymo Wash Buffer
spin through, discard waste.
spin for 90 seconds, full speed to dry.
elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction

6. Set up another PCR reaction with FaCCOMT-2_oligo_12 and FaCCOMT-2_oligo_14.