SBB13Ntbk-SeeYoungLee: Difference between revisions
No edit summary |
No edit summary |
||
Line 2: | Line 2: | ||
'' There were no colonies on the plate. There was a systematic error in the experiment, possibly during the ligation step. So I went back to the Eco/Bam digest step without running on gel and went straight to zymo cleanup using the following procedure. '' | '' There were no colonies on the plate. There was a systematic error in the experiment, possibly during the ligation step. So I went back to the Eco/Bam digest step without running on gel and went straight to zymo cleanup using the following procedure. '' | ||
Setup: | Setup: |
Revision as of 10:40, 2 April 2013
April 2, 2013
There were no colonies on the plate. There was a systematic error in the experiment, possibly during the ligation step. So I went back to the Eco/Bam digest step without running on gel and went straight to zymo cleanup using the following procedure.
Setup:
1. 8uL of eluted PCR product
2. 1uL of NEB Buffer 2
3. 0.5uL EcoRI
4. 0.5uL BamHI
Protocol:
1. Incubate at 37°C on the thermocycler for 1 hour.
2. Transfer into the Zymo column inside a collection tube.
3. Spin through, discard waste.
4. Add 200uL of Zymo Wash Buffer.
5. Spin through, discard waste.
6. Add 200uL of Zymo Wash Buffer.
7. Spin through, discard waste.
8. Spin for 90 seconds, full speed to dry.
9. Elute with 8uL of water into a fresh Eppendorf tube.
March 21, 2013
Ligation of EcoRI/BamHI Digests
Setup:
6.5uL ddH2O
1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
1uL Vector digest
1uL Insert digest
0.5uL T4 DNA Ligase
Protocol:
1. Pound upside down on the bench to mix.
2. Give it a quick spin to send it back to the bottom of the tube.
3. Incubate on the benchtop for 30 mins.
4. Put on ice and proceed to the transformation.
Transformation by Heat-shock
1. Thaw a 200uL aliquot of cells on ice.
2. Add 50uL of water to the cells.
3. Add 30uL of KCM to the cells.
4. Put your ligation mixture on ice, let cool a minute or two.
5. Add 70uL of the cell cocktail to the ligation, stir to mix.
6. Let sit on ice for 10 min.
7. Heat shock for 90 seconds at 42°C.
8. Put back on ice for 1 min.
9. Add 100uL of 2YT.
10. Plate 70+uL on ampicillin, let incubate at 37°C overnight.
March 19, 2013
Zymo Gel Purification
Last time, I added ADB buffer and heated the gel at 55°C and vortexed it
1. Transfer into the Zymo column inside a collection tube.
2. Spin through, discard waste.
3. Add 200uL of Zymo Wash Buffer.
4. Spin through, discard waste.
5. Add 200uL of Zymo Wash Buffer.
6. Spin through, discard waste.
7. Spin for 90 seconds, full speed to dry.
8. Elute with 8uL of water into a fresh Eppendorf tube
Today, I only performed the gel purification so that people who are behind could catch up. We will perform ligation and transformation together as a class next time.
March 14, 2013
The gel is of the PCA2 products for the synthons. The first lane is the His-tag part's IPCR product, the second lane is the molecular weight standards, and the tenth lane is my PCA2 product. It looks good and I can proceed to zymo cleanup.
Zymo Cleanup of Amplification Reaction
1. Add 180uL of Zymo ADB buffer to a 50uL reaction.
2. Transfer into the Zymo column.
3. Spin through, discard waste.
4. Add 200uL of Zymo Wash Buffer.
5. Spin through, discard waste.
6. Add 200uL of Zymo Wash Buffer.
7. Spin through, discard waste.
8. Spin for 90 seconds, full speed to dry.
9. Elute with 50uL of ddH2O into a fresh Eppendorf tube.
EcoRI/BamHI Digest of PCR Product
Setup:
1. 8uL of eluted PCR product
2. 1uL of NEB Buffer 2
3. 0.5uL EcoRI
4. 0.5uL BamHI
Protocol:
1. Incubate at 37°C on the thermocycler for 1 hour.
2. Run an agarose gel.
3. Cut out appropriate bands minimizing extra gel matter.
4. Put in Eppendorf tube and add 600uL of Zymo ADB buffer.
5. Heat at 55°C, vortex until the gel has dissolved.
After performing zymo cleanup of the amplification reaction, I proceeded to EcoRI/BamHI digest of my product. I ran an agarose gel, cut out the appropriate bands, and dissolved the gel in an Eppendorf tube. I will continue with the gel purification steps next time.
March 12, 2013
Zymo Cleanup of PCA1
1. Add 180uL of Zymo ADB buffer to a 50uL reaction.
2. Transfer into the Zymo column.
3. Spin through, discard waste.
4. Add 200uL of Zymo Wash Buffer.
5. Spin through, discard waste.
6. Add 200uL of Zymo Wash Buffer.
7. Spin through, discard waste.
8. Spin for 90 seconds, full speed to dry.
9. Elute with 50uL of ddH2O into a fresh Eppendorf tube.
PCA2 Assembly of FaCCOMT-1
1uL each FaCCOMT-1_oligo_1 and FaCCOMT-1_oligo_7 (Made a 10uM dilution with 2uL of external oligo and 18uL of ddH2O)
1uL purified PCA product
0.5uL phusion
10uL 5x phusion buffer
5uL 2mM dNTPs
32.5uL ddH2O
PCA2 (Performed by instructor)
1. 2 min initial denature at 94°C
2. 30 sec denature at 94°C
3. 30 sec anneal at 60°C
4. 30 sec extension at 68°C
repeat 2-4 30 times total
Expected PCR product:
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGATGGGATCTACCGGTGAAACACAAATGACTCCTACACACGTTTCAGACGAAGAGGCTAACTTGTTTGCAATGCAATTGGCCTCAGCCTCTGTTTTACCAATGGTCTTAAAGGCAGCAATTGAATTGGACTTGTTGGAAATCATGGCTAAAGCTGGTCCAGGTTCTTTCTTGTCACCATCTGACTTGGCCTCACAATTACCTACTAAGAATCCTGAAGCTCCTGTTATGTTGGACAGAATGTTGAGATTGTTGGCTTCTTACTCTATTTTGACTTGTTCATTAAGAACTTTGCCAGATGGTAAAGTAGAGAGATTGTATTGTTTGGGTCCAGTCTGTAAATTCTTGACTAAGAATGAAGATGTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
(456 bp)
Today, I performed a zymo cleanup of the PCA1 product following the procedures enumerated above. Then, I set up the assembly for PCA2 reaction and handed over the tubes to the instructor for PCA2 protocol.
March 8, 2013
PCA1 Assembly of FaCCOMT-1
38uL ddH2O
5uL 10x expand buffer
5uL 2mM dNTPs
1uL oligo mixture (100uM total, dilution prepared by instructor)
0.75uL Expand polymerase
PCA1 (Performed by instructor)
1. 2 min initial denature at 94°C
2. 30 sec denature at 94°C
3. 30 sec anneal at 55°C
4. 30 sec extension at 72°C
repeat 2-4 30 times total
Expected PCR product:
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGATGGGATCTACCGGTGAAACACAAATGACTCCTACACACGTTTCAGACGAAGAGGCTAACTTGTTTGCAATGCAATTGGCCTCAGCCTCTGTTTTACCAATGGTCTTAAAGGCAGCAATTGAATTGGACTTGTTGGAAATCATGGCTAAAGCTGGTCCAGGTTCTTTCTTGTCACCATCTGACTTGGCCTCACAATTACCTACTAAGAATCCTGAAGCTCCTGTTATGTTGGACAGAATGTTGAGATTGTTGGCTTCTTACTCTATTTTGACTTGTTCATTAAGAACTTTGCCAGATGGTAAAGTAGAGAGATTGTATTGTTTGGGTCCAGTCTGTAAATTCTTGACTAAGAATGAAGATGTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
(456 bp)
Today, I just setup the assembly for PCA1 and handed over the PCR tube to the instructor for PCA1 protocol.
March 5, 2013
Construction File
Mix oligos (FaCCOMT-1_oligo_1-16) for one synthon, do PCA1 protocol (456 bp, PCA1) PCR PCA1 with FaCCOMT-1_oligo_1/FaCCOMT-1_oligo_7 by PCA2 protocol (456 bp, PCA2) Digest PCA2, gp (EcoRI/BamHI, 411+20+25 bp, pcrdig) (get pre-digested vector from JCA of pBca9145-Bca1144) (EcoRI/BamHI, vectdig) Ligate pcrdig and vectdig (pBca9145-FaCCOMT-1)
Oligos were assigned as follows:
FaCCOMT-1_oligo_1 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCACATCTTCATTCTTAG
FaCCOMT-1_oligo_2 AAGTCAGATGGTGACAAGAAAGAACCTGGACCAGCTTTAGCCATGATTTCCAAC
FaCCOMT-1_oligo_3 AAGTCCAATTCAATTGCTGCCTTTAAGACCATTGGTAAAACAGAGGCTGAGGCC
FaCCOMT-1_oligo_4 AATTGCATTGCAAACAAGTTAGCCTCTTCGTCTGAAACGTGTGTAGGAGTCATT
FaCCOMT-1_oligo_5 AGAGGCTAACTTGTTTGCAATGCAATTGGCCTCAGCCTCTGTTTTACCAATGGT
FaCCOMT-1_oligo_6 AGGTTCTTTCTTGTCACCATCTGACTTGGCCTCACAATTACCTACTAAGAATCC
FaCCOMT-1_oligo_7 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCC
FaCCOMT-1_oligo_8 ATTCTGTCCAACATAACAGGAGCTTCAGGATTCTTAGTAGGTAATTGTGAGGCC
FaCCOMT-1_oligo_9 CTTAAAGGCAGCAATTGAATTGGACTTGTTGGAAATCATGGCTAAAGCTGGTCC
FaCCOMT-1_oligo_10 GGCAAAGTTCTTAATGAACAAGTCAAAATAGAGTAAGAAGCCAACAATCTCAAC
FaCCOMT-1_oligo_11 GTTTGGGTCCAGTCTGTAAATTCTTGACTAAGAATGAAGATGTGAGACGGCAT
FaCCOMT-1_oligo_12 TATGATGGGATCTACCGGTGAAACACAAATGACTCCTACACACGTTTCAGACGA
FaCCOMT-1_oligo_13 TCAAGAATTTACAGACTGGACCCAAACAATACAATCTCTCTACTTTACCATCT
FaCCOMT-1_oligo_14 TGAAGCTCCTGTTATGTTGGACAGAATGTTGAGATTGTTGGCTTCTTACTCTAT
FaCCOMT-1_oligo_15 TGTGTTTCACCGGTAGATCCCATCATAGGAGACCGATGAGACGATGCAGATCTC
FaCCOMT-1_oligo_16 TTTGACTTGTTCATTAAGAACTTTGCCAGATGGTAAAGTAGAGAGATTGTATT
Oligos were designed and prepared by Anderson Lab