SBB13Ntbk-SeeYoungLee: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
Line 129: Line 129:


'' This is an acceptable stopping point. Proceed with Zymo gel purification next time. ''
'' This is an acceptable stopping point. Proceed with Zymo gel purification next time. ''


== March 12, 2013 ==
== March 12, 2013 ==

Revision as of 10:13, 21 March 2013

March 21, 2013

Ligation of EcoRI/BamHI Digests

Setup:

6.5uL ddH2O

1uL T4 DNA Ligase Buffer (small red or black-striped tubes)

1uL Vector digest

1uL Insert digest

0.5uL T4 DNA Ligase


Protocol:

1. Pound upside down on the bench to mix.

2. Give it a quick spin to send it back to the bottom of the tube.

3. Incubate on the benchtop for 30min.

4. Put on ice and proceed to the transformation.


Transformation by Heat-shock

1. Thaw a 200uL aliquot of cells on ice.

2. Add 50uL of water to the cells.

3. Add 30uL of KCM to the cells.

4. Put your ligation mixture on ice, let cool a minute or two.

5. Add 70uL of the cell cocktail to the ligation, stir to mix.

6. Let sit on ice for 10 min.

7. Heat shock for 90 seconds at 42°C.

8. Put back on ice for 1 min.

9. Add 100uL of 2YT, let shake in the 37°C incubator for 1 hour.

10. Plate 70+uL on selective antibiotics, let incubate at 37°C overnight.


March 19, 2013

Zymo Gel Purification

Last time, I added ADB buffer and heated the gel at 55°C and vortexed it

1. Transfer into the Zymo column inside a collection tube.

2. Spin through, discard waste.

3. Add 200uL of Zymo Wash Buffer.

4. Spin through, discard waste.

5. Add 200uL of Zymo Wash Buffer.

6. Spin through, discard waste.

7. Spin for 90 seconds, full speed to dry.

8. Elute with 8uL of water into a fresh Eppendorf tube

Stop here and perform ligation and transformation next time


March 14, 2013


The gel is of the PCA2 products for the synthons. The first lane is the His-tag part's IPCR product, the second lane is the molecular weight standards, and the tenth lane is my PCA2 product. It looks good and I can proceed to zymo cleanup.


Zymo Cleanup of Amplification Reaction

1. Add 180uL of Zymo ADB buffer to a 50uL reaction.

2. Transfer into the Zymo column.

3. Spin through, discard waste.

4. Add 200uL of Zymo Wash Buffer.

5. Spin through, discard waste.

6. Add 200uL of Zymo Wash Buffer.

7. Spin through, discard waste.

8. Spin for 90 seconds, full speed to dry.

9. Elute with 50uL of ddH2O into a fresh Eppendorf tube.


EcoRI/BamHI Digest of PCR Product

Setup:

1. 8uL of eluted PCR product

2. 1uL of NEB Buffer 2

3. 0.5uL EcoRI

4. 0.5uL BamHI


Protocol:

1. Incubate at 37°C on the thermocycler for 1 hour.

2. Run an agarose gel.

3. Cut out appropriate bands minimizing extra gel matter.

4. Put in Eppendorf tube and add 600uL of Zymo ADB buffer.

5. Heat at 55°C, vortex until the gel has dissolved.

This is an acceptable stopping point. Proceed with Zymo gel purification next time.


March 12, 2013

Zymo Cleanup of PCA1

1. Add 180uL of Zymo ADB buffer to a 50uL reaction.

2. Transfer into the Zymo column.

3. Spin through, discard waste.

4. Add 200uL of Zymo Wash Buffer.

5. Spin through, discard waste.

6. Add 200uL of Zymo Wash Buffer.

7. Spin through, discard waste.

8. Spin for 90 seconds, full speed to dry.

9. Elute with 50uL of ddH2O into a fresh Eppendorf tube.


PCA2 Assembly of FaCCOMT-1

1uL each FaCCOMT-1_oligo_1 and FaCCOMT-1_oligo_7 (Made a 10uM dilution with 2uL of external oligo and 18uL of ddH2O)

1uL purified PCA product

0.5uL phusion

10uL 5x phusion buffer

5uL 2mM dNTPs

32.5uL ddH2O


PCA2 (Performed by instructor)

1. 2 min initial denature at 94°C

2. 30 sec denature at 94°C

3. 30 sec anneal at 60°C

4. 30 sec extension at 68°C

repeat 2-4 30 times total

Expected PCR product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGATGGGATCTACCGGTGAAACACAAATGACTCCTACACACGTTTCAGACGAAGAGGCTAACTTGTTTGCAATGCAATTGGCCTCAGCCTCTGTTTTACCAATGGTCTTAAAGGCAGCAATTGAATTGGACTTGTTGGAAATCATGGCTAAAGCTGGTCCAGGTTCTTTCTTGTCACCATCTGACTTGGCCTCACAATTACCTACTAAGAATCCTGAAGCTCCTGTTATGTTGGACAGAATGTTGAGATTGTTGGCTTCTTACTCTATTTTGACTTGTTCATTAAGAACTTTGCCAGATGGTAAAGTAGAGAGATTGTATTGTTTGGGTCCAGTCTGTAAATTCTTGACTAAGAATGAAGATGTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

(456 bp)


March 8, 2013

PCA1 Assembly of FaCCOMT-1

38uL ddH2O

5uL 10x expand buffer

5uL 2mM dNTPs

1uL oligo mixture (100uM total, dilution prepared by instructor)

0.75uL Expand polymerase


PCA1 (Performed by instructor)

1. 2 min initial denature at 94°C

2. 30 sec denature at 94°C

3. 30 sec anneal at 55°C

4. 30 sec extension at 72°C

repeat 2-4 30 times total

Expected PCR product:

ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGATGGGATCTACCGGTGAAACACAAATGACTCCTACACACGTTTCAGACGAAGAGGCTAACTTGTTTGCAATGCAATTGGCCTCAGCCTCTGTTTTACCAATGGTCTTAAAGGCAGCAATTGAATTGGACTTGTTGGAAATCATGGCTAAAGCTGGTCCAGGTTCTTTCTTGTCACCATCTGACTTGGCCTCACAATTACCTACTAAGAATCCTGAAGCTCCTGTTATGTTGGACAGAATGTTGAGATTGTTGGCTTCTTACTCTATTTTGACTTGTTCATTAAGAACTTTGCCAGATGGTAAAGTAGAGAGATTGTATTGTTTGGGTCCAGTCTGTAAATTCTTGACTAAGAATGAAGATGTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT

(456 bp)


March 5, 2013

Construction File

Mix oligos (FaCCOMT-1_oligo_1-16) for one synthon, do PCA1 protocol        (456 bp, PCA1)

PCR PCA1 with FaCCOMT-1_oligo_1/FaCCOMT-1_oligo_7 by PCA2 protocol         (456 bp, PCA2)

Digest PCA2, gp                                                            (EcoRI/BamHI, 411+20+25 bp, pcrdig)
 
(get pre-digested vector from JCA of pBca9145-Bca1144)                     (EcoRI/BamHI, vectdig)
 
Ligate pcrdig and vectdig                                                  (pBca9145-FaCCOMT-1)


Oligos were assigned as follows:


FaCCOMT-1_oligo_1 AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCACATCTTCATTCTTAG

FaCCOMT-1_oligo_2 AAGTCAGATGGTGACAAGAAAGAACCTGGACCAGCTTTAGCCATGATTTCCAAC

FaCCOMT-1_oligo_3 AAGTCCAATTCAATTGCTGCCTTTAAGACCATTGGTAAAACAGAGGCTGAGGCC

FaCCOMT-1_oligo_4 AATTGCATTGCAAACAAGTTAGCCTCTTCGTCTGAAACGTGTGTAGGAGTCATT

FaCCOMT-1_oligo_5 AGAGGCTAACTTGTTTGCAATGCAATTGGCCTCAGCCTCTGTTTTACCAATGGT

FaCCOMT-1_oligo_6 AGGTTCTTTCTTGTCACCATCTGACTTGGCCTCACAATTACCTACTAAGAATCC

FaCCOMT-1_oligo_7 ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCC

FaCCOMT-1_oligo_8 ATTCTGTCCAACATAACAGGAGCTTCAGGATTCTTAGTAGGTAATTGTGAGGCC

FaCCOMT-1_oligo_9 CTTAAAGGCAGCAATTGAATTGGACTTGTTGGAAATCATGGCTAAAGCTGGTCC

FaCCOMT-1_oligo_10 GGCAAAGTTCTTAATGAACAAGTCAAAATAGAGTAAGAAGCCAACAATCTCAAC

FaCCOMT-1_oligo_11 GTTTGGGTCCAGTCTGTAAATTCTTGACTAAGAATGAAGATGTGAGACGGCAT

FaCCOMT-1_oligo_12 TATGATGGGATCTACCGGTGAAACACAAATGACTCCTACACACGTTTCAGACGA

FaCCOMT-1_oligo_13 TCAAGAATTTACAGACTGGACCCAAACAATACAATCTCTCTACTTTACCATCT

FaCCOMT-1_oligo_14 TGAAGCTCCTGTTATGTTGGACAGAATGTTGAGATTGTTGGCTTCTTACTCTAT

FaCCOMT-1_oligo_15 TGTGTTTCACCGGTAGATCCCATCATAGGAGACCGATGAGACGATGCAGATCTC

FaCCOMT-1_oligo_16 TTTGACTTGTTCATTAAGAACTTTGCCAGATGGTAAAGTAGAGAGATTGTATT


Oligos were designed and prepared by Anderson Lab