SBB13Ntbk-Robert Chen

From OpenWetWare

Revision as of 13:12, 12 March 2013 by Robert Chen (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

2013 03 06: Designed oligos for PCA1 on CCOMT-1 CCOMT1_Synthon PCA for oligos 1-11, 13-14, 16 (407bp, PCA1_pdt) PCA for oligos 12,15, PCA1_pdt (462bp, PCA2_pdt) Digest PCA2_pdt (417+26+19, EcoRI/BamHI, PCA2_dig) Digest pBca9145-Bca1144 (2967+2958+9, EcoRI/BglII, Vector_dig) Ligate PCA2_dig and Vector_dig (2474, Bca1144-CCOMT1)

CCOMT-1_oligo_12: ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT CCOMT-1_oligo_1: TTATTTGTGTCTCACCTGTAGATCCCATAGGAGACCGATGAGACGATGCAGATCT CCOMT-1_oligo_9: ATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAG CCOMT-1_oligo_3: GAGGCCAACTGCATTGCAAATAAGTTAGCTTCTTCATCAGAAATATGTGTAGGAG CCOMT-1_oligo_5: CTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAA CCOMT-1_oligo_4: CTCTAATAAGTCCAATTCTAAAGCTGATTTCAAAATCATAGGCAAAACTGAAGCA CCOMT-1_oligo_11: ATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGC CCOMT-1_oligo_2: TGAGGCAATTTCGATAGGTGAAATTTGTGCTCCAGGACCTGCCTTAGCAATAAT CCOMT-1_oligo_14: ACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGC CCOMT-1_oligo_6: CCTTAACATCCTATCCAACATTACTGGGGCATCAGGGTTTGTTGTTGGTAATTG CCOMT-1_oligo_7: CCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGAC CCOMT-1_oligo_3: ACCGTCTTGTTGTGTTCTTACAGAGCATGTCAATATAATATAGCAAGCTAATAA CCOMT-1_oligo_10: ATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGC CCOMT-1_oligo_8: ATTCTTAACTAAATATTTTGCTACTGTTGCTAATCCATACAATCTTTGTACCTT CCOMT-1_oligo_16: AACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA CCOMT-1_oligo_15: AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATAGAAACACCATCTTC

PCA1_pdt: AGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA PCA2_pdt: ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT Bca1144-CCOMT1: gAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg

Will perform PCA1 on 2013-03-08

2013 03 08: Did not have PCR plates - will perform PCA1 on CCOMT-1 on 2013-03-09

2013 03 09: Performed PCA1 on CCOMT-1

PCA Assembly OK, so you've got a bunch of oligos, now what? First, use this recipe and program to do initial assembly of the oligos (do a separate one of these reactions for each chunk you're assembling): Recipe 38 uL ddH2O 5 ul 10x expand buffer 5 ul 2mM dNTPs 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks) 0.75 ul Expand polymerase

From here, sample was given to John Wright: Program (can run JCA/PCA1) 2 min initial denature at 94oC 30 sec denature at 94oC 30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed] 30 sec extension at 72oC repeat 2-4 30 times total 2013 03 12 Regular Zymo Cleanup on PCA1 -> PCA2

Regular Zymo Cleanup The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.

1) Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. ADB kills proteins and allows DNA to stick to the column 2) Transfer into the Zymo column (small clear guys)

  -spin through (1 minute, max g), discard waste.

DNA is now stuck to white filtered column 3) Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) spin through, discard waste. 4) Add 200 uL of Zymo Wash Buffer

  -spin through, discard waste.

5) spin for 90 seconds, full speed to dry. 6) elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction

Personal tools