SBB13Ntbk-Robert Chen

2013 03 06: Designed oligos for PCA1 on CCOMT-1

CCOMT1_Synthon
PCA for oligos 1-11, 13-14, 16       (407bp, PCA1_pdt) 
PCA for oligos 12,15, PCA1_pdt       (462bp, PCA2_pdt)
Digest PCA2_pdt                      (417+26+19, EcoRI/BamHI, PCA2_dig)
Digest pBca9145-Bca1144              (2967+2958+9, EcoRI/BglII, Vector_dig)
Ligate PCA2_dig and Vector_dig       (2474, Bca1144-CCOMT1)

CCOMT-1_oligo_12:  ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT
CCOMT-1_oligo_1:  TTATTTGTGTCTCACCTGTAGATCCCATAGGAGACCGATGAGACGATGCAGATCT
CCOMT-1_oligo_9:  ATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAG
CCOMT-1_oligo_3:  GAGGCCAACTGCATTGCAAATAAGTTAGCTTCTTCATCAGAAATATGTGTAGGAG
CCOMT-1_oligo_5:  CTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAA
CCOMT-1_oligo_4:  CTCTAATAAGTCCAATTCTAAAGCTGATTTCAAAATCATAGGCAAAACTGAAGCA
CCOMT-1_oligo_11:  ATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGC
CCOMT-1_oligo_2:  TGAGGCAATTTCGATAGGTGAAATTTGTGCTCCAGGACCTGCCTTAGCAATAAT
CCOMT-1_oligo_14:  ACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGC
CCOMT-1_oligo_6:  CCTTAACATCCTATCCAACATTACTGGGGCATCAGGGTTTGTTGTTGGTAATTG
CCOMT-1_oligo_7:  CCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGAC
CCOMT-1_oligo_3:  ACCGTCTTGTTGTGTTCTTACAGAGCATGTCAATATAATATAGCAAGCTAATAA
CCOMT-1_oligo_10:  ATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGC
CCOMT-1_oligo_8:  ATTCTTAACTAAATATTTTGCTACTGTTGCTAATCCATACAATCTTTGTACCTT
CCOMT-1_oligo_16:  AACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA
CCOMT-1_oligo_15:  AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATAGAAACACCATCTTC
--
PCA1_pdt: AGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA
PCA2_pdt: ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
Bca1144-CCOMT1: gAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg

Will perform PCA1 on 2013-03-08

2013 03 08: Did not have PCR plates - will perform PCA1 on CCOMT-1 on 2013-03-09

2013 03 09: Performed PCA1 on CCOMT-1

'''PCA Assembly'''
-OK, so you've got a bunch of oligos, now what? First, use this recipe and program to do initial assembly of the oligos (do a separate one of these reactions for each chunk you're assembling):
Recipe
38 uL ddH2O
5 ul 10x expand buffer
5 ul 2mM dNTPs
1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
0.75 ul Expand polymerase-

From here, sample was given to John Wright:
Program (can run JCA/PCA1)
2 min initial denature at 94oC
30 sec denature at 94oC
30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed]
30 sec extension at 72oC
repeat 2-4 30 times total

2013 03 12 Regular Zymo Cleanup on PCA1 -> PCA2

Regular Zymo Cleanup
The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.

1) Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.
''ADB kills proteins and allows DNA to stick to the column''
2) Transfer into the Zymo column (small clear guys)
   -spin through (1 minute, max g), discard waste.
''DNA is now stuck to white filtered column''
3) Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
   -spin through, discard waste.
4) Add 200 uL of Zymo Wash Buffer
   -spin through, discard waste.
5) spin for 90 seconds, full speed to dry.
6) elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
   -Elute by spinning at max (14000g) for 1 minute
   -When spinning, face tube caps against direction of spin so cap doesn't break off.

Then perform PCA2:

'''Amplification'''
Now, you need to do an amplification of the correct full-length chunks. Clean up the assembly reaction with a zymo column; don't bother running it on a gel - it'll be a smeary mess and won't really help you. Save the purified product in case this step fails! For the amplification reaction, do a normal phusion program with 1 ul of the cleaned up assembly reaction as template, and using the outermost oligos for the chunk. That is:
'''Recipe'''
1 ul each outer oligo (10 uM)
   -Dilute F/R oligos 1:10 from 100uM; in this case, oligo CCOMT1-12/CCOMT1-15
1 ul purified pca product
.5 ul phusion
10 ul 5x phusion buffer
5 ul 2mM dNTPs
32.5 ul H2O

Samples given to John to run the Program. 1:10 Oligo12/Oligo15 dilutions in small PCR tubes. Also stored purified PCA1 product in 4o box.

'''Program'''
2 min initial denature at 94oC
30 sec denature at 94oC
30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product]
30 sec extension at 68oC
repeat 2-4 30 times total

2013 03 14 Gel from ALL class samples: File:Http://openwetware.org/images/f/fc/2013 03 13-JCA-gel1.jpg This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification. My sample is one of the last 3 lanes (probably 3rd or 2nd to last

Zymo Cleanup on PCA2 product

1. Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.
2. Transfer into the Zymo column (small clear guys)
3. spin through, discard waste.
4. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
5. spin through, discard waste.
6. Add 200 uL of Zymo Wash Buffer
7. spin through, discard waste.
8. spin for 90 seconds, full speed to dry.
9. elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction

EcoRI/BamHI Digest on PCA2_zymd

1. 1uL of NEB Buffer 2 (ADD THIS FIRST)
2. 8uL of eluted PCR product
3. 0.5uL EcoRI
4. 0.5uL BamHI

Incubate at 37 degrees on the thermocycler for 1hr
Run an agarose gel, and melt with 600uL ADB buffer at 55 degrees. ****NOTE: If you are running short of time, this is an acceptable stopping point
If the DNA is shorter than 300bp, add 250uL of isopropanol and mix prior to loading it on the column

Zymo Gel Purification

1. Add 2uL Loading Dye to 10uL sample
2. Load all of sample into well
  -Gel "R" lane 5
3. Run gel @ 180V (Maximum before temperature heats gel to melt) ~20 minutes
4. Cut band out and incubate in 300uL ADB buffer until gel melted
5. Place in Fridge

Stopped here, will finish next week.

Robert Chen 13:07, 19 March 2013 (EDT)

Zymo Cleanup after Gel Purification

1. transfer into the Zymo column inside a collection tube (small clear guys)
2. spin through, discard waste.
3. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
4. spin through, discard waste.
5. Add 200 uL of Zymo Wash Buffer
6. spin through, discard waste.
7. spin for 90 seconds, full speed to dry.
8. elute with water into a fresh Eppendorf tube. Water amount should be same as DNA input - '''8uL'''

Robert Chen 14:10, 21 March 2013 (EDT)

Ligation -> Heat Shock -> Plating

Ligation of EcoRI/BamHI digests

 6.5uL ddH2O
 1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
 1uL Vector digest
 1uL Insert digest
 0.5uL T4 DNA Ligase

Pound upside down on the bench to mix
Give it a quick spin to send it back to the bottom of the tube
Incubate on the benchtop for 30min
Put on ice and proceed to the transformation

Transformation Take competent cells to which TSS has been added. Heat shock Rescue with 2YT

Thaw a 200 uL aliquot of cells on ice
Add 50 uL of water to the cells (if greater volume is desired)
Add 30 uL of KCM to the cells 
Put your ligation mixture on ice, let cool a minute or two (for Miniprep product, dilute by 10, then use 1uL of dilution)
Add 70 uL of the cell cocktail to the ligation, stir to mix
Let sit on ice for 10 min
Heat shock for 90 seconds at 42 (longer incubation may work better)
Put back on ice for 1 min
Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour (DID NOT RESCUE FOR 1 HOUR BECAUSE AMPICILLIN)
Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight