SBB13Ntbk-Robert Chen

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 71: Line 71:
6) elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
6) elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
   -elute by spinning at max (14000g) for 1 minute</pre>
   -elute by spinning at max (14000g) for 1 minute</pre>
 +
 +
Then perform PCA2:
 +
 +
<pre>'''Amplification'''
 +
Now, you need to do an amplification of the correct full-length chunks. Clean up the assembly reaction with a zymo column; don't bother running it on a gel - it'll be a smeary mess and won't really help you. Save the purified product in case this step fails! For the amplification reaction, do a normal phusion program with 1 ul of the cleaned up assembly reaction as template, and using the outermost oligos for the chunk. That is:
 +
'''Recipe'''
 +
1 ul each outer oligo (10 uM)
 +
  -Dilute F/R oligos 1:10 from 100uM; in this case, oligo CCOMT1-12/CCOMT1-15
 +
1 ul purified pca product
 +
.5 ul phusion
 +
10 ul 5x phusion buffer
 +
5 ul 2mM dNTPs
 +
32.5 ul H2O
 +
'''Program'''
 +
2 min initial denature at 94oC
 +
30 sec denature at 94oC
 +
30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product]
 +
30 sec extension at 68oC
 +
repeat 2-4 30 times total</pre>

Revision as of 12:46, 12 March 2013

2013 03 06: Designed oligos for PCA1 on CCOMT-1

CCOMT1_Synthon
PCA for oligos 1-11, 13-14, 16       (407bp, PCA1_pdt) 
PCA for oligos 12,15, PCA1_pdt       (462bp, PCA2_pdt)
Digest PCA2_pdt                      (417+26+19, EcoRI/BamHI, PCA2_dig)
Digest pBca9145-Bca1144              (2967+2958+9, EcoRI/BglII, Vector_dig)
Ligate PCA2_dig and Vector_dig       (2474, Bca1144-CCOMT1)

CCOMT-1_oligo_12:  ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT
CCOMT-1_oligo_1:  TTATTTGTGTCTCACCTGTAGATCCCATAGGAGACCGATGAGACGATGCAGATCT
CCOMT-1_oligo_9:  ATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAG
CCOMT-1_oligo_3:  GAGGCCAACTGCATTGCAAATAAGTTAGCTTCTTCATCAGAAATATGTGTAGGAG
CCOMT-1_oligo_5:  CTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAA
CCOMT-1_oligo_4:  CTCTAATAAGTCCAATTCTAAAGCTGATTTCAAAATCATAGGCAAAACTGAAGCA
CCOMT-1_oligo_11:  ATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGC
CCOMT-1_oligo_2:  TGAGGCAATTTCGATAGGTGAAATTTGTGCTCCAGGACCTGCCTTAGCAATAAT
CCOMT-1_oligo_14:  ACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGC
CCOMT-1_oligo_6:  CCTTAACATCCTATCCAACATTACTGGGGCATCAGGGTTTGTTGTTGGTAATTG
CCOMT-1_oligo_7:  CCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGAC
CCOMT-1_oligo_3:  ACCGTCTTGTTGTGTTCTTACAGAGCATGTCAATATAATATAGCAAGCTAATAA
CCOMT-1_oligo_10:  ATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGC
CCOMT-1_oligo_8:  ATTCTTAACTAAATATTTTGCTACTGTTGCTAATCCATACAATCTTTGTACCTT
CCOMT-1_oligo_16:  AACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA
CCOMT-1_oligo_15:  AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATAGAAACACCATCTTC

PCA1_pdt: AGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA PCA2_pdt: ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT Bca1144-CCOMT1: gAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg

Will perform PCA1 on 2013-03-08

2013 03 08: Did not have PCR plates - will perform PCA1 on CCOMT-1 on 2013-03-09

2013 03 09: Performed PCA1 on CCOMT-1

-PCA Assembly -OK, so you've got a bunch of oligos, now what? First, use this recipe and program to do initial assembly of the oligos (do a separate one of these reactions for each chunk you're assembling): Recipe 38 uL ddH2O 5 ul 10x expand buffer 5 ul 2mM dNTPs 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks) 0.75 ul Expand polymerase-

From here, sample was given to John Wright: Program (can run JCA/PCA1) 2 min initial denature at 94oC 30 sec denature at 94oC 30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed] 30 sec extension at 72oC repeat 2-4 30 times total 2013 03 12 Regular Zymo Cleanup on PCA1 -> PCA2

Regular Zymo Cleanup
The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.

1) Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.
''ADB kills proteins and allows DNA to stick to the column''
2) Transfer into the Zymo column (small clear guys)
   -spin through (1 minute, max g), discard waste.
''DNA is now stuck to white filtered column''
3) Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
   -spin through, discard waste.
4) Add 200 uL of Zymo Wash Buffer
   -spin through, discard waste.
5) spin for 90 seconds, full speed to dry.
6) elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
   -elute by spinning at max (14000g) for 1 minute

Then perform PCA2:

'''Amplification'''
Now, you need to do an amplification of the correct full-length chunks. Clean up the assembly reaction with a zymo column; don't bother running it on a gel - it'll be a smeary mess and won't really help you. Save the purified product in case this step fails! For the amplification reaction, do a normal phusion program with 1 ul of the cleaned up assembly reaction as template, and using the outermost oligos for the chunk. That is:
'''Recipe'''
1 ul each outer oligo (10 uM)
   -Dilute F/R oligos 1:10 from 100uM; in this case, oligo CCOMT1-12/CCOMT1-15
1 ul purified pca product
.5 ul phusion
10 ul 5x phusion buffer
5 ul 2mM dNTPs
32.5 ul H2O
'''Program'''
2 min initial denature at 94oC
30 sec denature at 94oC
30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product]
30 sec extension at 68oC
repeat 2-4 30 times total
Personal tools