SBB13Ntbk-Robert Chen

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New page: '''2013 03 06:''' Designed oligos for PCA1 on CCOMT-1 CCOMT1_Synthon PCA for oligos 1-11, 13-14, 16 (407bp, PCA1_pdt) PCA for oligos 12,15, PCA1_pdt (462bp, PCA2_pdt) Digest P...)
Line 1: Line 1:
'''2013 03 06:'''
'''2013 03 06:'''
Designed oligos for PCA1 on CCOMT-1
Designed oligos for PCA1 on CCOMT-1
-
CCOMT1_Synthon
+
<pre>CCOMT1_Synthon
PCA for oligos 1-11, 13-14, 16      (407bp, PCA1_pdt)  
PCA for oligos 1-11, 13-14, 16      (407bp, PCA1_pdt)  
PCA for oligos 12,15, PCA1_pdt      (462bp, PCA2_pdt)
PCA for oligos 12,15, PCA1_pdt      (462bp, PCA2_pdt)
Line 23: Line 23:
CCOMT-1_oligo_8:  ATTCTTAACTAAATATTTTGCTACTGTTGCTAATCCATACAATCTTTGTACCTT
CCOMT-1_oligo_8:  ATTCTTAACTAAATATTTTGCTACTGTTGCTAATCCATACAATCTTTGTACCTT
CCOMT-1_oligo_16:  AACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA
CCOMT-1_oligo_16:  AACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA
-
CCOMT-1_oligo_15:  AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATAGAAACACCATCTTC
+
CCOMT-1_oligo_15:  AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATAGAAACACCATCTTC</pre>
PCA1_pdt: AGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA
PCA1_pdt: AGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA
Line 37: Line 37:
Performed PCA1 on CCOMT-1
Performed PCA1 on CCOMT-1
-
''PCA Assembly''
+
-'''PCA Assembly'''
-
OK, so you've got a bunch of oligos, now what? First, use this recipe and program to do initial assembly of the oligos (do a separate one of these reactions for each chunk you're assembling):
+
-OK, so you've got a bunch of oligos, now what? First, use this recipe and program to do initial assembly of the oligos (do a separate one of these reactions for each chunk you're assembling):
Recipe
Recipe
38 uL ddH2O
38 uL ddH2O
Line 44: Line 44:
5 ul 2mM dNTPs
5 ul 2mM dNTPs
1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
-
0.75 ul Expand polymerase
+
0.75 ul Expand polymerase-
From here, sample was given to John Wright:
From here, sample was given to John Wright:
Line 56: Line 56:
Regular Zymo Cleanup on PCA1 -> PCA2
Regular Zymo Cleanup on PCA1 -> PCA2
-
Regular Zymo Cleanup
+
<pre>Regular Zymo Cleanup
The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.
The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.
Line 65: Line 65:
''DNA is now stuck to white filtered column''
''DNA is now stuck to white filtered column''
3) Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
3) Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
-
spin through, discard waste.
+
  -spin through, discard waste.
4) Add 200 uL of Zymo Wash Buffer
4) Add 200 uL of Zymo Wash Buffer
   -spin through, discard waste.
   -spin through, discard waste.
5) spin for 90 seconds, full speed to dry.
5) spin for 90 seconds, full speed to dry.
-
6) elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
+
6) elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction</pre>

Revision as of 13:16, 12 March 2013

2013 03 06: Designed oligos for PCA1 on CCOMT-1

CCOMT1_Synthon
PCA for oligos 1-11, 13-14, 16       (407bp, PCA1_pdt) 
PCA for oligos 12,15, PCA1_pdt       (462bp, PCA2_pdt)
Digest PCA2_pdt                      (417+26+19, EcoRI/BamHI, PCA2_dig)
Digest pBca9145-Bca1144              (2967+2958+9, EcoRI/BglII, Vector_dig)
Ligate PCA2_dig and Vector_dig       (2474, Bca1144-CCOMT1)

CCOMT-1_oligo_12:  ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT
CCOMT-1_oligo_1:  TTATTTGTGTCTCACCTGTAGATCCCATAGGAGACCGATGAGACGATGCAGATCT
CCOMT-1_oligo_9:  ATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAG
CCOMT-1_oligo_3:  GAGGCCAACTGCATTGCAAATAAGTTAGCTTCTTCATCAGAAATATGTGTAGGAG
CCOMT-1_oligo_5:  CTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAA
CCOMT-1_oligo_4:  CTCTAATAAGTCCAATTCTAAAGCTGATTTCAAAATCATAGGCAAAACTGAAGCA
CCOMT-1_oligo_11:  ATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGC
CCOMT-1_oligo_2:  TGAGGCAATTTCGATAGGTGAAATTTGTGCTCCAGGACCTGCCTTAGCAATAAT
CCOMT-1_oligo_14:  ACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGC
CCOMT-1_oligo_6:  CCTTAACATCCTATCCAACATTACTGGGGCATCAGGGTTTGTTGTTGGTAATTG
CCOMT-1_oligo_7:  CCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGAC
CCOMT-1_oligo_3:  ACCGTCTTGTTGTGTTCTTACAGAGCATGTCAATATAATATAGCAAGCTAATAA
CCOMT-1_oligo_10:  ATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGC
CCOMT-1_oligo_8:  ATTCTTAACTAAATATTTTGCTACTGTTGCTAATCCATACAATCTTTGTACCTT
CCOMT-1_oligo_16:  AACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA
CCOMT-1_oligo_15:  AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATAGAAACACCATCTTC

PCA1_pdt: AGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA PCA2_pdt: ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT Bca1144-CCOMT1: gAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg

Will perform PCA1 on 2013-03-08

2013 03 08: Did not have PCR plates - will perform PCA1 on CCOMT-1 on 2013-03-09

2013 03 09: Performed PCA1 on CCOMT-1

-PCA Assembly -OK, so you've got a bunch of oligos, now what? First, use this recipe and program to do initial assembly of the oligos (do a separate one of these reactions for each chunk you're assembling): Recipe 38 uL ddH2O 5 ul 10x expand buffer 5 ul 2mM dNTPs 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks) 0.75 ul Expand polymerase-

From here, sample was given to John Wright: Program (can run JCA/PCA1) 2 min initial denature at 94oC 30 sec denature at 94oC 30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed] 30 sec extension at 72oC repeat 2-4 30 times total 2013 03 12 Regular Zymo Cleanup on PCA1 -> PCA2

Regular Zymo Cleanup
The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.

1) Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.
''ADB kills proteins and allows DNA to stick to the column''
2) Transfer into the Zymo column (small clear guys)
   -spin through (1 minute, max g), discard waste.
''DNA is now stuck to white filtered column''
3) Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
   -spin through, discard waste.
4) Add 200 uL of Zymo Wash Buffer
   -spin through, discard waste.
5) spin for 90 seconds, full speed to dry.
6) elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
Personal tools