SBB13Ntbk-Robert Chen
From OpenWetWare
| Line 95: | Line 95: | ||
30 sec extension at 68oC | 30 sec extension at 68oC | ||
repeat 2-4 30 times total</pre> | repeat 2-4 30 times total</pre> | ||
| + | |||
| + | '''2013 03 14''' | ||
| + | Gel from ALL class samples: | ||
| + | [[Image:http://openwetware.org/images/f/fc/2013_03_13-JCA-gel1.jpg]] | ||
| + | This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification. '''My sample is one of the last 3 lanes (probably 3rd or 2nd to last''' | ||
| + | |||
| + | 'Zymo Cleanup on PCA2 product' | ||
| + | <pre>1. Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. | ||
| + | 2. Transfer into the Zymo column (small clear guys) | ||
| + | 3. spin through, discard waste. | ||
| + | 4. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) | ||
| + | 5. spin through, discard waste. | ||
| + | 6. Add 200 uL of Zymo Wash Buffer | ||
| + | 7. spin through, discard waste. | ||
| + | 8. spin for 90 seconds, full speed to dry. | ||
| + | 9. elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction</pre> | ||
| + | |||
| + | 'EcoRI/BamHI Digest on PCA2_zymd' | ||
| + | <pre> | ||
| + | 1. 1uL of NEB Buffer 2 (ADD THIS FIRST) | ||
| + | 2. 8uL of eluted PCR product | ||
| + | 3. 0.5uL EcoRI | ||
| + | 4. 0.5uL BamHI | ||
| + | |||
| + | Incubate at 37 degrees on the thermocycler for 1hr | ||
| + | Run an agarose gel, and melt with 600uL ADB buffer at 55 degrees. ****NOTE: If you are running short of time, this is an acceptable stopping point | ||
| + | If the DNA is shorter than 300bp, add 250uL of isopropanol and mix prior to loading it on the column</pre> | ||
| + | |||
| + | <pre>'Zymo Gel Purification' | ||
| + | 1. Add 2uL Loading Dye to 10uL sample | ||
| + | 2. Load all of sample into well | ||
| + | -Gel "R" lane 5 | ||
| + | 3. Run gel @ 180V (Maximum before temperature heats gel to melt) ~20 minutes | ||
| + | 4. Cut band out and incubate in 300uL ADB buffer until gel melted | ||
| + | 5. Place in Fridge</pre> | ||
| + | |||
| + | Stopped here, will finish next week. | ||
Revision as of 16:16, 15 March 2013
2013 03 06: Designed oligos for PCA1 on CCOMT-1
CCOMT1_Synthon PCA for oligos 1-11, 13-14, 16 (407bp, PCA1_pdt) PCA for oligos 12,15, PCA1_pdt (462bp, PCA2_pdt) Digest PCA2_pdt (417+26+19, EcoRI/BamHI, PCA2_dig) Digest pBca9145-Bca1144 (2967+2958+9, EcoRI/BglII, Vector_dig) Ligate PCA2_dig and Vector_dig (2474, Bca1144-CCOMT1) CCOMT-1_oligo_12: ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCT CCOMT-1_oligo_1: TTATTTGTGTCTCACCTGTAGATCCCATAGGAGACCGATGAGACGATGCAGATCT CCOMT-1_oligo_9: ATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAG CCOMT-1_oligo_3: GAGGCCAACTGCATTGCAAATAAGTTAGCTTCTTCATCAGAAATATGTGTAGGAG CCOMT-1_oligo_5: CTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAA CCOMT-1_oligo_4: CTCTAATAAGTCCAATTCTAAAGCTGATTTCAAAATCATAGGCAAAACTGAAGCA CCOMT-1_oligo_11: ATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGC CCOMT-1_oligo_2: TGAGGCAATTTCGATAGGTGAAATTTGTGCTCCAGGACCTGCCTTAGCAATAAT CCOMT-1_oligo_14: ACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGC CCOMT-1_oligo_6: CCTTAACATCCTATCCAACATTACTGGGGCATCAGGGTTTGTTGTTGGTAATTG CCOMT-1_oligo_7: CCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGAC CCOMT-1_oligo_3: ACCGTCTTGTTGTGTTCTTACAGAGCATGTCAATATAATATAGCAAGCTAATAA CCOMT-1_oligo_10: ATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGC CCOMT-1_oligo_8: ATTCTTAACTAAATATTTTGCTACTGTTGCTAATCCATACAATCTTTGTACCTT CCOMT-1_oligo_16: AACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA CCOMT-1_oligo_15: AAGTATCTTTCCTGTGCCCAGGATCCATGCCGTCTCATAGAAACACCATCTTC -- PCA1_pdt: AGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCA PCA2_pdt: ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT Bca1144-CCOMT1: gAATTCATGAGATCTGCATCGTCTCATCGGTCTCCTATGGGATCTACAGGTGAGACACAAATAACTCCTACACATATTTCTGATGAAGAAGCTAACTTATTTGCAATGCAGTTGGCCTCTGCTTCAGTTTTGCCTATGATTTTGAAATCAGCTTTAGAATTGGACTTATTAGAGATTATTGCTAAGGCAGGTCCTGGAGCACAAATTTCACCTATCGAAATTGCCTCACAATTACCAACAACAAACCCTGATGCCCCAGTAATGTTGGATAGGATGTTAAGGTTATTAGCTTGCTATATTATATTGACATGCTCTGTAAGAACACAACAAGACGGTAAGGTACAAAGATTGTATGGATTAGCAACAGTAGCAAAATATTTAGTTAAGAATGAAGATGGTGTTTCTATGAGACGGCATGGATCCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg
Will perform PCA1 on 2013-03-08
2013 03 08: Did not have PCR plates - will perform PCA1 on CCOMT-1 on 2013-03-09
2013 03 09: Performed PCA1 on CCOMT-1
'''PCA Assembly''' -OK, so you've got a bunch of oligos, now what? First, use this recipe and program to do initial assembly of the oligos (do a separate one of these reactions for each chunk you're assembling): Recipe 38 uL ddH2O 5 ul 10x expand buffer 5 ul 2mM dNTPs 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks) 0.75 ul Expand polymerase- From here, sample was given to John Wright: Program (can run JCA/PCA1) 2 min initial denature at 94oC 30 sec denature at 94oC 30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed] 30 sec extension at 72oC repeat 2-4 30 times total
2013 03 12 Regular Zymo Cleanup on PCA1 -> PCA2
Regular Zymo Cleanup The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction. 1) Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. ''ADB kills proteins and allows DNA to stick to the column'' 2) Transfer into the Zymo column (small clear guys) -spin through (1 minute, max g), discard waste. ''DNA is now stuck to white filtered column'' 3) Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) -spin through, discard waste. 4) Add 200 uL of Zymo Wash Buffer -spin through, discard waste. 5) spin for 90 seconds, full speed to dry. 6) elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction -Elute by spinning at max (14000g) for 1 minute -When spinning, face tube caps against direction of spin so cap doesn't break off.
Then perform PCA2:
'''Amplification''' Now, you need to do an amplification of the correct full-length chunks. Clean up the assembly reaction with a zymo column; don't bother running it on a gel - it'll be a smeary mess and won't really help you. Save the purified product in case this step fails! For the amplification reaction, do a normal phusion program with 1 ul of the cleaned up assembly reaction as template, and using the outermost oligos for the chunk. That is: '''Recipe''' 1 ul each outer oligo (10 uM) -Dilute F/R oligos 1:10 from 100uM; in this case, oligo CCOMT1-12/CCOMT1-15 1 ul purified pca product .5 ul phusion 10 ul 5x phusion buffer 5 ul 2mM dNTPs 32.5 ul H2O Samples given to John to run the Program. 1:10 Oligo12/Oligo15 dilutions in small PCR tubes. Also stored purified PCA1 product in 4o box. '''Program''' 2 min initial denature at 94oC 30 sec denature at 94oC 30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product] 30 sec extension at 68oC repeat 2-4 30 times total
2013 03 14 Gel from ALL class samples: Image:Http://openwetware.org/images/f/fc/2013 03 13-JCA-gel1.jpg This gel is of the PCA2 products for the various synthons. The first lane is the His-tag part's IPCR product (currently unnamed), then molecular weight standards, then the rest are your PCA2's (I couldn't read the labels). All but three look fine. Lanes 4 and 8 look recoverable with a second PCR. The lane 3's reaction needs to be started over from scratch. Lane 7 just needs a careful gel purification. My sample is one of the last 3 lanes (probably 3rd or 2nd to last
'Zymo Cleanup on PCA2 product'
1. Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. 2. Transfer into the Zymo column (small clear guys) 3. spin through, discard waste. 4. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) 5. spin through, discard waste. 6. Add 200 uL of Zymo Wash Buffer 7. spin through, discard waste. 8. spin for 90 seconds, full speed to dry. 9. elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
'EcoRI/BamHI Digest on PCA2_zymd'
1. 1uL of NEB Buffer 2 (ADD THIS FIRST) 2. 8uL of eluted PCR product 3. 0.5uL EcoRI 4. 0.5uL BamHI Incubate at 37 degrees on the thermocycler for 1hr Run an agarose gel, and melt with 600uL ADB buffer at 55 degrees. ****NOTE: If you are running short of time, this is an acceptable stopping point If the DNA is shorter than 300bp, add 250uL of isopropanol and mix prior to loading it on the column
'Zymo Gel Purification' 1. Add 2uL Loading Dye to 10uL sample 2. Load all of sample into well -Gel "R" lane 5 3. Run gel @ 180V (Maximum before temperature heats gel to melt) ~20 minutes 4. Cut band out and incubate in 300uL ADB buffer until gel melted 5. Place in Fridge
Stopped here, will finish next week.


