SBB12Ntbk-Tina Nie: Difference between revisions
No edit summary |
|||
Line 129: | Line 129: | ||
After the incubation time I added 100 uL of Zymo ADB buffer to each reaction (first step of small-frag Zymo clean-up) to kill the enzymes. I will finish the Zymo clean-up next lab class. | After the incubation time I added 100 uL of Zymo ADB buffer to each reaction (first step of small-frag Zymo clean-up) to kill the enzymes. I will finish the Zymo clean-up next lab class. | ||
==--[[User:Tina Nie|Tina Nie]] 13:40, 23 February 2012 (EST)== |
Revision as of 11:40, 23 February 2012
--Tina Nie 14:25, 16 February 2012 (EST))
First day of labwork: Set up two PCR reactions. Set up wobble reaction for sbb1227:
Wobble tn001F/tn002R (64bp, wobpdt) Digest wobpdt (NheI/BamHI, L, wobdig) Digest pBca9525-Bca1834 (NheI/BamHI, L, vectdig) Ligate wobdig and vectdig (pBca9525-sbb1227) {Leu8} ---------------------------------------------------------------------- >tn001F Forward construction of sbb1227 basic part ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTG >tn002R Reverse construction of sbb1227 basic part CTGATggatccTTACAGGAGTAGCAGCAACAGTAGCAGaccag >wobpdt ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTGCTACTCCTGTAAggatccATCAG
Using protocol:
- 29 uL water
- 5 uL Expand 10x Buffer 2
- 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc)
- 5 uL Oligo 1 (100uM)
- 5 uL Oligo 2 (100uM)
- 0.75 uL Expand Polymerase 1
Set up PCA1 (assembly) reaction for sbb1213:
PCA1 on o15,o11,o12 (pca1) PCA2 with o15/o12 on pca1 (139 bp, pca2) Digest pca2 (NheI/BamHI, L, 1213dig) Digest pBca9525-Bca1834 (NheI/BamHI, L, vectdig) Ligate 1213dig + vectdig, product is pBca9525-sbb1213 ---- >o15 CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGT >o11 CAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGA >o12 CAGTAGGATCCTTAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT >pca2 CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTAAGGATCCTACTG
Using protocol:
- 38 uL ddH2O
- 5 ul 10x expand buffer
- 5 ul 2mM dNTPs
- 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
- 0.75 ul Expand polymerase
Both programs run for us after class.
Dilutions I made to make up 100uM solutions:
tn001F: 23.4nM + 234uL ddH2O
tn002R: 23.4nM + 234uL ddH2O
O15: 86.1nM + 861uL ddH2O
--Tina Nie 17:19, 17 February 2012 (EST)
Used Small Fragment Zymo Cleanup on both the wobble reaction product (for sbb1227) and the PCA1 product(for sbb1213), using the following protocol:
- Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction.
- Transfer into the Zymo column (small clear guys)
- Add 500uL of Ethanol and pipette up and down to mix
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer
- spin through, discard waste.
- spin for 90 seconds, full speed to dry.
- elute with water (spin 60s) into a fresh Eppendorf tube
I used 50uL of ddH2O to elute.
After Small-frag Zymo I set up the PCA amplification reaction (PCA2), using the following protocol:
- 1 ul each outer oligo (10 uM)
- 1 ul purified pca product
- .5 ul phusion
- 10 ul 5x phusion buffer
- 5 ul 2mM dNTPs
- 32.5 ul H2O
The PCR program was run for us after class.
--Tina Nie 13:25, 21 February 2012 (EST)
I used Small-frag Zymo to purify the PCA2 product, following the protocol:
- Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction.
- Transfer into the Zymo column (small clear guys)
- Add 500uL of Ethanol and pipette up and down to mix
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer
- spin through, discard waste.
- spin for 90 seconds, full speed to dry.
- elute with water (spin 60s) into a fresh Eppendorf tube
using 51uL of ddH2O to elute.
After the Zymo clean up I ran the product on an analytic gel to check I had the right product.
I used 6uL of the purified DNA and 4uL of loading dye in the gel.
In my column there was a very faint band at about 100 bases (by comparison with the DNA ladder). It may be consistent with the PCA2 product which should be 139bp but it is difficult to tell.
I set up the digestion reaction for sbb1227 (Leu8) using the following protocol:
50uL eluted DNA 5.7uL NEB Buffer 2 0.5uL NheI 0.5uL BamHI
I incubated this for 1 hour at 37 degrees.
I also set up the digestion for sbb1213 (lz_AAAA-2) using the following:
8uL of eluted PCR product 1uL of NEB Buffer 2 0.5uL NheI 0.5uL BamHI
and incubated at 37 degrees for 1 hour.
After the incubation time I added 100 uL of Zymo ADB buffer to each reaction (first step of small-frag Zymo clean-up) to kill the enzymes. I will finish the Zymo clean-up next lab class.