SBB12Ntbk-Tina Nie: Difference between revisions
No edit summary |
No edit summary |
||
Line 87: | Line 87: | ||
The PCR program was run for us after class. | The PCR program was run for us after class. | ||
==--[[User:Tina Nie|Tina Nie]] 13:25, 21 February 2012 (EST)== | |||
I used Small-frag Zymo to purify the PCA2 product, following the protocol: | |||
#Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction. | |||
#Transfer into the Zymo column (small clear guys) | |||
#Add 500uL of Ethanol and pipette up and down to mix | |||
#spin through (15s), discard waste. | |||
#Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) | |||
#spin through (15s), discard waste. | |||
#Add 200 uL of Zymo Wash Buffer | |||
#spin through, discard waste. | |||
#spin for 90 seconds, full speed to dry. | |||
#elute with water (spin 60s) into a fresh Eppendorf tube | |||
using 55uL of ddH2O to elute. | |||
After the Zymo clean up I ran the product on an analytic gel to check I had the right product. | |||
I used 6uL of the purified DNA and 4uL of loading dye in the gel. |
Revision as of 11:25, 21 February 2012
--Tina Nie 14:25, 16 February 2012 (EST))
First day of labwork: Set up two PCR reactions. Set up wobble reaction for sbb1227:
Wobble tn001F/tn002R (64bp, wobpdt) Digest wobpdt (NheI/BamHI, L, wobdig) Digest pBca9525-Bca1834 (NheI/BamHI, L, vectdig) Ligate wobdig and vectdig (pBca9525-sbb1227) {Leu8} ---------------------------------------------------------------------- >tn001F Forward construction of sbb1227 basic part ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTG >tn002R Reverse construction of sbb1227 basic part CTGATggatccTTACAGGAGTAGCAGCAACAGTAGCAGaccag >wobpdt ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTGCTACTCCTGTAAggatccATCAG
Using protocol:
- 29 uL water
- 5 uL Expand 10x Buffer 2
- 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc)
- 5 uL Oligo 1 (100uM)
- 5 uL Oligo 2 (100uM)
- 0.75 uL Expand Polymerase 1
Set up PCA1 (assembly) reaction for sbb1213:
PCA1 on o15,o11,o12 (pca1) PCA2 with o15/o12 on pca1 (139 bp, pca2) Digest pca2 (NheI/BamHI, L, 1213dig) Digest pBca9525-Bca1834 (NheI/BamHI, L, vectdig) Ligate 1213dig + vectdig, product is pBca9525-sbb1213 ---- >o15 CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGT >o11 CAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGA >o12 CAGTAGGATCCTTAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT >pca2 CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTAAGGATCCTACTG
Using protocol:
- 38 uL ddH2O
- 5 ul 10x expand buffer
- 5 ul 2mM dNTPs
- 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
- 0.75 ul Expand polymerase
Both programs run for us after class.
Dilutions I made to make up 100uM solutions:
tn001F: 23.4nM + 234uL ddH2O
tn002R: 23.4nM + 234uL ddH2O
O15: 86.1nM + 861uL ddH2O
--Tina Nie 17:19, 17 February 2012 (EST)
Used Small Fragment Zymo Cleanup on both the wobble reaction product (for sbb1227) and the PCA1 product(for sbb1213), using the following protocol:
- Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction.
- Transfer into the Zymo column (small clear guys)
- Add 500uL of Ethanol and pipette up and down to mix
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer
- spin through, discard waste.
- spin for 90 seconds, full speed to dry.
- elute with water (spin 60s) into a fresh Eppendorf tube
I used 50uL of ddH2O to elute.
After Small-frag Zymo I set up the PCA amplification reaction (PCA2), using the following protocol:
- 1 ul each outer oligo (10 uM)
- 1 ul purified pca product
- .5 ul phusion
- 10 ul 5x phusion buffer
- 5 ul 2mM dNTPs
- 32.5 ul H2O
The PCR program was run for us after class.
--Tina Nie 13:25, 21 February 2012 (EST)
I used Small-frag Zymo to purify the PCA2 product, following the protocol:
- Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction.
- Transfer into the Zymo column (small clear guys)
- Add 500uL of Ethanol and pipette up and down to mix
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
- spin through (15s), discard waste.
- Add 200 uL of Zymo Wash Buffer
- spin through, discard waste.
- spin for 90 seconds, full speed to dry.
- elute with water (spin 60s) into a fresh Eppendorf tube
using 55uL of ddH2O to elute.
After the Zymo clean up I ran the product on an analytic gel to check I had the right product.
I used 6uL of the purified DNA and 4uL of loading dye in the gel.