SBB11Ntbk-SuhaniVora: Difference between revisions
Suhani Vora (talk | contribs) |
Suhani Vora (talk | contribs) |
||
(17 intermediate revisions by the same user not shown) | |||
Line 7: | Line 7: | ||
-Resuspended oligos PmalK_R and SV_06 to 100 uM. <br> | -Resuspended oligos PmalK_R and SV_06 to 100 uM. <br> | ||
-Diluted primers to 10 uM. <br> | -Diluted primers to 10 uM. <br> | ||
-Set up PCR for cloning using | -Set up PCR for cloning using [http://openwetware.org/wiki/Template:SBB-Protocols_PCR2 Cloning by PCR Protocol] <br> | ||
1. P_malk <br> | 1. P_malk <br> | ||
2. P_nlpA <br> | 2. P_nlpA <br> | ||
Line 60: | Line 60: | ||
P_nlpA PCR failed yesterday. Will have to move on without that part.<br> | P_nlpA PCR failed yesterday. Will have to move on without that part.<br> | ||
EcoRI/BamHI Digest of P_rfaQ (sbb1121) and P_malK (sbb1134)<br> | EcoRI/BamHI Digest of P_rfaQ (sbb1121) and P_malK (sbb1134) using [http://openwetware.org/wiki/Template:SBB-Protocols_Enz2 Using EcoRI/BamHI Digest Protocol]<br> | ||
Place in thermocycler at 37 deg for 1 hr.<br> | Place in thermocycler at 37 deg for 1 hr.<br> | ||
Lane 3: sbb1121 (P_rfaQ) [1031 bp] | Gel E Lane 3: sbb1121 (P_rfaQ) [1031 bp]<br> | ||
Lane 4: sbb1134 (P_malK) [525 bp] | Gel E Lane 4: sbb1134 (P_malK) [525 bp] <br> | ||
Gel was checked and cut by Prof. Anderson. | |||
''Shout out to Chris for hookin' us up with some sweet PCR.'' | |||
(Gel cut out by Prof. Anderson, thanks!) | |||
==[[User:Suhani Vora|Suhani Vora]] 13:59, 24 February 2011 (EST)== | |||
Zymo Gel Purification of sbb1121 and sbb1134 using[http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Zymo Gel Purification Protocol] | |||
Eluted in 8ul DDW | |||
Happy Birthday [http://openwetware.org/wiki/Image:VM.jpg Vinidhra Mani]!!! | |||
==[[User:Suhani Vora|Suhani Vora]] 14:31, 1 March 2011 (EST)== | |||
Ligation of sbb1121 and sbb1134 (EcoRI/BamHI) into pBjh1601KC--Bca114(EcoRI/BamHI) | |||
Followed [http://openwetware.org/wiki/Template:SBB-Protocols_Enz4 Ligation of EcoRI/BamHI digests Protocol] | |||
Transformation of pBjh1601KC-sbb1121 and pBjh1601KC-sbb1134 into competent E. coli cells. | |||
Followed [http://openwetware.org/wiki/Template:SBB-Protocols_Micro1 Transformation by Heat-shock Protocol] | |||
Plated on Kanamycin plates | |||
==[[User:Suhani Vora|Suhani Vora]] 14:03, 3 March 2011 (EST)== | |||
Plates look fine, transformation plates for both rxn. with ssb1121 and ssb1134 had over 100 single colonies | |||
Colonies were picked for us, 4 cultures of each rxn. were given to us. | |||
Mini-prepped cultures ssb1121 #1-4 and ssb1134 #1-4 following [http://openwetware.org/wiki/Template:SBB-Protocols_Micro3 Miniprep Purification of DNA Protocol] | |||
==[[User:Suhani Vora|Suhani Vora]] 14:48, 8 March 2011 (EST)== | |||
Mapping Plasmid Preps <br> | |||
Followed [http://openwetware.org/wiki/Template:SBB-Protocols_Enz6 Template Mapping Protocol] for ssb121 #1-4 and ssb1134 #1-4 <br> | |||
Ran Analytical Gels <br> | |||
Loaded Gel Lanes (Gel #1): <br> | |||
1. 5 ul Ladder <br> | |||
10. sbb1121 #1 <br> | |||
11. sbb1121 #2 <br> | |||
12. sbb1121 #3 <br> | |||
13. sbb1121 #4 <br> | |||
[[Image:030811-Gel1.jpg]] <br> | |||
All look good: 3131 bp + 1031 bp | |||
Loaded Gel Lanes (Gel #2): <br> | |||
1. 5 ul Ladder <br> | |||
2. sbb1134 #1 <br> | |||
3. sbb1134 #2 <br> | |||
4. sbb1134 #3 <br> | |||
5. sbb1134 #4 <br> | |||
[[Image:030811-Gel2.jpg]] <br> | |||
All look good : 3131 bp + 525 bp | |||
==[[User:Suhani Vora|Suhani Vora]] 13:08, 10 March 2011 (EST)== | |||
Sent sbb1121 #3 and #4 for sequencing | |||
Sent sbb1134 #1 and #2 for sequencing | |||
Both were correct. |
Latest revision as of 20:06, 5 April 2011
~~!~~
Suhani Vora 14:08, 15 February 2011 (EST)
Today we set up PCR reactions for our promoter parts.
-Resuspended oligos PmalK_R and SV_06 to 100 uM.
-Diluted primers to 10 uM.
-Set up PCR for cloning using Cloning by PCR Protocol
1. P_malk
2. P_nlpA
3. P_rfaQ
Thermocycler Program: 2K55
Construction Files:
PCR ss61f/P_malKR on E. coli MG1655 gDNA (525 bp, EcoRI/BamHI) Sub into pBjh1601KC-Bca1144 (EcoRI/BamHI, 3131+910 bp, L) Product is pBjh1601KC-sbb1134 {P_malK} ---------------------------------------------------------------- ss61f BglBrick basic part cloning of lamB promoter AAACCGAATTCATGAGATCTATGCGGATAATGCGAGGATGCGTGCACCTG P_malkR BglBrick basic part cloning of lamB promoter CTGATggatccACCTTCATGGATATCGAGATTG Part sbb1132 {P_nlpA} PCR ss58r/SV_06 on MG1655 gen. (542bp, EcoRI/BamHI) Sub into pBjh1601KC-Bca1144#5 (EcoRI/BamHI, 3131+910, L) Product is pBjh1601KC-sbb1132 {P_nlpA} ------------------------------------------------------ ss58r Forward Cloning of P_nlpA aaaccGAATTCatgAGATCTgcttcccaataattgctctg SV_06 P_nlpAR (reverse cloning of P_nlpA BglBricks basic part) CTGATGGATCCCCGTAGATGATGTGTTGTCAG Part sbb1121 {P_rfaQ} PCR ss47r/ss47f on MG1655 gen. (1031bp, EcoRI/BamHI) Sub into pBjh1601KC-Bca1144#5 (EcoRI/BamHI, 3131+910, L) Product is pBjh1601KC-sbb1121 {P_rfaQ} ------------------------------------------------------ ss47fReverse Cloning of P_rfaQ tttggGGATCCttttcagacaaaatagggatggtgtcctg ss47rForward Cloning of P_rfaQ aaaccGAATTCatgAGATCTattttacgtttatgtagcgccgcaatcagg
Suhani Vora 13:24, 17 February 2011 (EST)
Ran PCR samples of P_malK, P_nlpA, P_rfaQ on analytical gel.
2ul Sample + 5 uL Loading Dye Buffer
Sample 1 [Lane 3]: P_malK (525 bp)
Sample 2 [Lane 4]: P_nlpA (542 bp)
Sample 3 [Lane 5]: P_rfaQ (1031 bp)
Cleaned with Zymo Cleanup : May have used wrong buffer.
All PCR products for the class were thrown out, re-done by Prof. Anderson.
Suhani Vora 13:37, 22 February 2011 (EST)
P_nlpA PCR failed yesterday. Will have to move on without that part.
EcoRI/BamHI Digest of P_rfaQ (sbb1121) and P_malK (sbb1134) using Using EcoRI/BamHI Digest Protocol
Place in thermocycler at 37 deg for 1 hr.
Gel E Lane 3: sbb1121 (P_rfaQ) [1031 bp]
Gel E Lane 4: sbb1134 (P_malK) [525 bp]
Gel was checked and cut by Prof. Anderson.
Shout out to Chris for hookin' us up with some sweet PCR.
(Gel cut out by Prof. Anderson, thanks!)
Suhani Vora 13:59, 24 February 2011 (EST)
Zymo Gel Purification of sbb1121 and sbb1134 usingZymo Gel Purification Protocol
Eluted in 8ul DDW
Happy Birthday Vinidhra Mani!!!
Suhani Vora 14:31, 1 March 2011 (EST)
Ligation of sbb1121 and sbb1134 (EcoRI/BamHI) into pBjh1601KC--Bca114(EcoRI/BamHI)
Followed Ligation of EcoRI/BamHI digests Protocol
Transformation of pBjh1601KC-sbb1121 and pBjh1601KC-sbb1134 into competent E. coli cells.
Followed Transformation by Heat-shock Protocol
Plated on Kanamycin plates
Suhani Vora 14:03, 3 March 2011 (EST)
Plates look fine, transformation plates for both rxn. with ssb1121 and ssb1134 had over 100 single colonies
Colonies were picked for us, 4 cultures of each rxn. were given to us.
Mini-prepped cultures ssb1121 #1-4 and ssb1134 #1-4 following Miniprep Purification of DNA Protocol
Suhani Vora 14:48, 8 March 2011 (EST)
Mapping Plasmid Preps
Followed Template Mapping Protocol for ssb121 #1-4 and ssb1134 #1-4
Ran Analytical Gels
Loaded Gel Lanes (Gel #1):
1. 5 ul Ladder
10. sbb1121 #1
11. sbb1121 #2
12. sbb1121 #3
13. sbb1121 #4
All look good: 3131 bp + 1031 bp
Loaded Gel Lanes (Gel #2):
1. 5 ul Ladder
2. sbb1134 #1
3. sbb1134 #2
4. sbb1134 #3
5. sbb1134 #4
All look good : 3131 bp + 525 bp
Suhani Vora 13:08, 10 March 2011 (EST)
Sent sbb1121 #3 and #4 for sequencing Sent sbb1134 #1 and #2 for sequencing
Both were correct.