SBB11Ntbk-NikitPatel

Constructing Basic Parts

Nikit Patel 11:30, 15 February 2011 (EST)

Thought of the day: Did my first PCR after 3 years at Berkeley!

• Create 100uM stock of oligos: P_sbp_inR and SS50r
  
• Followed Cloning by PCR Protocol:
  

- Used construction files below to setup PCR

- Did first part of SOEing for P_sbp basic part

- Thermocycler Program: 2K55

Construction of P_sbp BglBrick basic part sbb1124
PCR ss50f/P_sbp_inR on MG1655	(247 bp, gp = A)
PCR P_sbp_inF/ss50r on MG1655	(492 bp, gp = B)
---------------------------------------------------
PCR ss50f/ss50r on A+B	                (710 bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144 		(EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1124           {P_sbp}
---------------------------------------------------			
P_sbp_inR	Reverse removal of EcoRI site in P_sbp	
CAATAAATTGCAGAAGTCATGTAGGCCTG		
P_sbp_inF	Forward removal of EcoRI site in P_sbp	
CAGGCCTACATGACTTCTGCAATTTATTG		
ss50f	sbp
aaaccGAATTCatgAGATCTgcggtcgttgtgtaggtatccag
ss50r	sbp
tttggGGATCCcaacatcagcttcaataccgttg

Part sbb1104                            {P_fadL}
PCR ss29f/ss29r on MG1655 gen.          (611bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144#5           (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1104           {P_fadL}
---------------------------------------------------
ss29fForward Cloning of P_fadL     aaaccGAATTCatgAGATCTgctttttcagtcagcgccgccag
ss29rReverse Cloning of P_fadL     tttggGGATCCgataagtgccactgcgactgcgagagc

Nikit Patel 12:35, 17 February 2011 (EST)

Thought of the day: Is it me or is ADB buffer like magic? It annihilated the gel so fast!

• P_sbp Products A and B

- Ran preparative gel

- Lanes 2 and 3 from gel (below) confirmed sizes around 250 and 500 bp respectively

- Bands were cut

- Performed Zymo Gel Purification on both A + B

- Setup and run PCR for SOEing using Zymo Gel Purified DNA as template. (Used 2K55 mode for thermocycler)

• P_fadL Products

- Ran analytical gel (prepped 2uL DNA + 5uL Dye)

- Band in lane 2 from gel (below) confirmed size around 600 bp

- Perform Regular Zymo Cleanup

Nikit Patel 18:17, 18 February 2011 (EST)

Thought of the day: Nikit + Gary = Best SOEing partners!

• P_sbp SOEing PCR products

- Ran analytical gel

- Lane 2 from gel (below) confirmed size around 750 bp. (SOEing worked!)

- Performed Regular Zymo Cleanup

Nikit Patel 14:29, 22 February 2011 (EST)

Thought of the day: Shout out to Professor Anderson for redoing our PCRs. We will never forget this.

• PCRs were redone. Analytical Gel Lane 14 (below) confirms successful PCR product

• P_sbp (Part sbb1124)

- Performed analytical gel

- Lane 1 below confirms SOEing worked

• P_fadL (Part sbb1104)

- Performed EcoRI/BamHI Digest

- Digest run for 1 hour in thermocycler

- Run preparative gel (below)

- Added 600 uL of ADB buffer to Lane 5 band

Nikit Patel 13:48, 24 February 2011 (EST)

Thought of the day: It's Vini's birthday today! I also found out that Gary is a funny guy.

• P_sbp (Part sbb1124)

- Gels were cut and loaded with ADB buffer by Professor Anderson the day before

- Performed EcoRI/BamHI Digest

- Digest run for 1 hour in thermocycler

- Ran preparative gel. Lane 1 is my band! (below)

- Performed rest of Zymo Gel Purification

- Labelled as "sbb1124 Cut and Cleaned"

• P_fadL (Part sbb1104)

- Performed rest of Zymo Gel Purification

- Eluted in 8 uL of water

- Labelled as "sbb1104 Cut and Cleaned"

Nikit Patel 14:59, 1 March 2011 (EST)

Thought of the day: Sad that UCB Ph.D candidates are visiting today and I'm not one of them.

• Performed ligation reaction on both parts

- Used pBjh1601KC-Bca1144 vectors for both

- Incubated on bench top for 30 minutes

• Performed transformation by heat-shock on ligation products

- Shared cells with Gary

- Heat shocked for 120 seconds

Nikit Patel 3:44, 3 March 2011 (EST)

Thought of the day: Marcus was acting really hyper during lab. It was entertaining!"

• Plate had many colonies.
• Four colonies were picked from each plate for us
• Performed Miniprep Purification on the 8 cultures

Nikit Patel 13:37, 8 March 2011 (EST)

Thought of the day: I want Sergey to add me on Words with Friends!

• Performed Analytical Mapping Digests on all 8 minipreps
• Ran the digested products on a gel (below)

- Lane #5  : sbb1104 #1

- Lane #6  : sbb1104 #2

- Lane #7  : sbb1104 #3

- Lane #8  : sbb1104 #4

- Lane #9  : sbb1124 #1

- Lane #10 : sbb1124 #2

- Lane #11 : sbb1124 #3

- Lane #12 : sbb1124 #4

Nikit Patel 13:00, 10 March 2011 (EST)

Thought of the day: BioE 100 midterm is stealing my mind away from BioE 140L midterm!

• Lane 11 doesn't look good.
• Therefore, we will be putting in sbb1104 #1/2 and sbb1124 #1/2 for sequencing