SBB11Ntbk-NikitPatel: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Nikit Patel (talk | contribs) |
Nikit Patel (talk | contribs) |
||
(34 intermediate revisions by the same user not shown) | |||
Line 2: | Line 2: | ||
==[[User:Nikit Patel|Nikit Patel]] 11:30, 15 February 2011 (EST)== | ==[[User:Nikit Patel|Nikit Patel]] 11:30, 15 February 2011 (EST)== | ||
''Thought of the day: '' | ''Thought of the day: Did my first PCR after 3 years at Berkeley!'' | ||
* Create 100uM stock of oligos: P_sbp_inR and SS50r <br> | * Create 100uM stock of oligos: P_sbp_inR and SS50r <br> | ||
Line 55: | Line 55: | ||
:- Band in lane 2 from gel (below) confirmed size around 600 bp | :- Band in lane 2 from gel (below) confirmed size around 600 bp | ||
:- Perform [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo1 Regular Zymo Cleanup] | :- Perform [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo1 Regular Zymo Cleanup] | ||
:[[Image:021711-AnalGel2.jpg | 250px]] | :[[Image:021711-AnalGel2.jpg | 250px]] | ||
==[[User:Nikit Patel|Nikit Patel]] 18:17, 18 February 2011 (EST)== | ==[[User:Nikit Patel|Nikit Patel]] 18:17, 18 February 2011 (EST)== | ||
''Thought of the day: Nikit + [http://openwetware.org/ | ''Thought of the day: Nikit + [http://openwetware.org/images/0/0c/Gary_Profile.jpg Gary] = Best SOEing partners!'' | ||
* P_sbp SOEing PCR products | * P_sbp SOEing PCR products | ||
:- Ran | :- Ran analytical gel | ||
:- Lane 2 from gel confirmed size around 750 bp. (SOEing worked!) | :- Lane 2 from gel (below) confirmed size around 750 bp. (SOEing worked!) | ||
:- Performed Regular Zymo Cleanup | :- Performed Regular Zymo Cleanup | ||
:[[Image:021811-AnalGel1.jpg | 250 px]] | |||
==[[User:Nikit Patel|Nikit Patel]] 14:29, 22 February 2011 (EST)== | |||
''Thought of the day: Shout out to Professor Anderson for redoing our PCRs. We will never forget this.'' | |||
* PCRs were redone. Analytical Gel Lane 14 (below) confirms successful PCR product | |||
:[[Image:022111-AnalGel2.jpg | 250 px]] | |||
* P_sbp (Part sbb1124) | |||
:- Performed analytical gel | |||
:- Lane 1 below confirms SOEing worked | |||
:[[Image:022211-AnalGel1.jpg | 250 px]] | |||
* P_fadL (Part sbb1104) | |||
:- Performed [http://openwetware.org/wiki/Template:SBB-Protocols_Enz2 EcoRI/BamHI Digest] | |||
:- Digest run for 1 hour in thermocycler | |||
:- Run preparative gel (below) | |||
:- Added 600 uL of ADB buffer to Lane 5 band | |||
:[[Image:022211-PrepGel5.jpg | 250 px]] | |||
==[[User:Nikit Patel|Nikit Patel]] 13:48, 24 February 2011 (EST)== | |||
''Thought of the day: It's Vini's birthday today! I also found out that Gary is a funny guy.'' | |||
* P_sbp (Part sbb1124) | |||
:- Gels were cut and loaded with ADB buffer by Professor Anderson the day before | |||
:- Performed EcoRI/BamHI Digest | |||
:- Digest run for 1 hour in thermocycler | |||
:- Ran preparative gel. Lane 1 is my band! (below) | |||
:- Performed rest of Zymo Gel Purification | |||
:- Labelled as "sbb1124 Cut and Cleaned" | |||
:[[Image:022411-PrepGel1.jpg | 250 px]] | |||
* P_fadL (Part sbb1104) | |||
:- Performed rest of Zymo Gel Purification | |||
:- Eluted in 8 uL of water | |||
:- Labelled as "sbb1104 Cut and Cleaned" | |||
==[[User:Nikit Patel|Nikit Patel]] 14:59, 1 March 2011 (EST)== | |||
''Thought of the day: Sad that UCB Ph.D candidates are visiting today and I'm not one of them.'' | |||
* Performed [http://openwetware.org/wiki/Template:SBB-Protocols_Enz4 ligation reaction] on both parts | |||
:- Used pBjh1601KC-Bca1144 vectors for both | |||
:- Incubated on bench top for 30 minutes | |||
* Performed [http://openwetware.org/wiki/Template:SBB-Protocols_Micro1 transformation] by heat-shock on ligation products | |||
:- Shared cells with Gary | |||
:- Heat shocked for 120 seconds | |||
==[[User:Nikit Patel|Nikit Patel]] 3:44, 3 March 2011 (EST)== | |||
''Thought of the day: Marcus was acting really hyper during lab. It was entertaining!" | |||
* Plate had many colonies. | |||
* Four colonies were picked from each plate for us | |||
* Performed [http://openwetware.org/wiki/Template:SBB-Protocols_Micro3 Miniprep Purification] on the 8 cultures | |||
==[[User:Nikit Patel|Nikit Patel]] 13:37, 8 March 2011 (EST)== | |||
''Thought of the day: I want Sergey to add me on Words with Friends!'' | |||
* Performed [http://openwetware.org/wiki/Template:SBB-Protocols_Enz6 Analytical Mapping Digests] on all 8 minipreps | |||
* Ran the digested products on a gel (below) | |||
:- Lane #5 : sbb1104 #1 | |||
:- Lane #6 : sbb1104 #2 | |||
:- Lane #7 : sbb1104 #3 | |||
:- Lane #8 : sbb1104 #4 | |||
:- Lane #9 : sbb1124 #1 | |||
:- Lane #10 : sbb1124 #2 | |||
:- Lane #11 : sbb1124 #3 | |||
:- Lane #12 : sbb1124 #4 | |||
:[[Image:030811-Gel2.jpg | 250 px]] | |||
==[[User:Nikit Patel|Nikit Patel]] 13:00, 10 March 2011 (EST)== | |||
''Thought of the day: BioE 100 midterm is stealing my mind away from BioE 140L midterm!'' | |||
* Lane 11 doesn't look good. | |||
* Therefore, we will be putting in sbb1104 #1/2 and sbb1124 #1/2 for sequencing |
Latest revision as of 11:16, 10 March 2011
Constructing Basic Parts
Nikit Patel 11:30, 15 February 2011 (EST)
Thought of the day: Did my first PCR after 3 years at Berkeley!
- Create 100uM stock of oligos: P_sbp_inR and SS50r
- Followed Cloning by PCR Protocol:
- - Used construction files below to setup PCR
- - Did first part of SOEing for P_sbp basic part
- - Thermocycler Program: 2K55
Construction of P_sbp BglBrick basic part sbb1124 PCR ss50f/P_sbp_inR on MG1655 (247 bp, gp = A) PCR P_sbp_inF/ss50r on MG1655 (492 bp, gp = B) --------------------------------------------------- PCR ss50f/ss50r on A+B (710 bp, EcoRI/BamHI) Sub into pBjh1601KC-Bca1144 (EcoRI/BamHI, 3131+910, L) Product is pBjh1601KC-sbb1124 {P_sbp} --------------------------------------------------- P_sbp_inR Reverse removal of EcoRI site in P_sbp CAATAAATTGCAGAAGTCATGTAGGCCTG P_sbp_inF Forward removal of EcoRI site in P_sbp CAGGCCTACATGACTTCTGCAATTTATTG ss50f sbp aaaccGAATTCatgAGATCTgcggtcgttgtgtaggtatccag ss50r sbp tttggGGATCCcaacatcagcttcaataccgttg
Part sbb1104 {P_fadL} PCR ss29f/ss29r on MG1655 gen. (611bp, EcoRI/BamHI) Sub into pBjh1601KC-Bca1144#5 (EcoRI/BamHI, 3131+910, L) Product is pBjh1601KC-sbb1104 {P_fadL} --------------------------------------------------- ss29fForward Cloning of P_fadL aaaccGAATTCatgAGATCTgctttttcagtcagcgccgccag ss29rReverse Cloning of P_fadL tttggGGATCCgataagtgccactgcgactgcgagagc
Nikit Patel 12:35, 17 February 2011 (EST)
Thought of the day: Is it me or is ADB buffer like magic? It annihilated the gel so fast!
- P_sbp Products A and B
- - Ran preparative gel
- - Lanes 2 and 3 from gel (below) confirmed sizes around 250 and 500 bp respectively
- - Bands were cut
- - Performed Zymo Gel Purification on both A + B
- - Setup and run PCR for SOEing using Zymo Gel Purified DNA as template. (Used 2K55 mode for thermocycler)
- P_fadL Products
- - Ran analytical gel (prepped 2uL DNA + 5uL Dye)
- - Band in lane 2 from gel (below) confirmed size around 600 bp
- - Perform Regular Zymo Cleanup
Nikit Patel 18:17, 18 February 2011 (EST)
Thought of the day: Nikit + Gary = Best SOEing partners!
- P_sbp SOEing PCR products
- - Ran analytical gel
- - Lane 2 from gel (below) confirmed size around 750 bp. (SOEing worked!)
- - Performed Regular Zymo Cleanup
Nikit Patel 14:29, 22 February 2011 (EST)
Thought of the day: Shout out to Professor Anderson for redoing our PCRs. We will never forget this.
- PCRs were redone. Analytical Gel Lane 14 (below) confirms successful PCR product
- P_sbp (Part sbb1124)
- P_fadL (Part sbb1104)
- - Performed EcoRI/BamHI Digest
- - Digest run for 1 hour in thermocycler
- - Run preparative gel (below)
- - Added 600 uL of ADB buffer to Lane 5 band
Nikit Patel 13:48, 24 February 2011 (EST)
Thought of the day: It's Vini's birthday today! I also found out that Gary is a funny guy.
- P_sbp (Part sbb1124)
- - Gels were cut and loaded with ADB buffer by Professor Anderson the day before
- - Performed EcoRI/BamHI Digest
- - Digest run for 1 hour in thermocycler
- - Ran preparative gel. Lane 1 is my band! (below)
- - Performed rest of Zymo Gel Purification
- - Labelled as "sbb1124 Cut and Cleaned"
- P_fadL (Part sbb1104)
- - Performed rest of Zymo Gel Purification
- - Eluted in 8 uL of water
- - Labelled as "sbb1104 Cut and Cleaned"
Nikit Patel 14:59, 1 March 2011 (EST)
Thought of the day: Sad that UCB Ph.D candidates are visiting today and I'm not one of them.
- Performed ligation reaction on both parts
- - Used pBjh1601KC-Bca1144 vectors for both
- - Incubated on bench top for 30 minutes
- Performed transformation by heat-shock on ligation products
- - Shared cells with Gary
- - Heat shocked for 120 seconds
Nikit Patel 3:44, 3 March 2011 (EST)
Thought of the day: Marcus was acting really hyper during lab. It was entertaining!"
- Plate had many colonies.
- Four colonies were picked from each plate for us
- Performed Miniprep Purification on the 8 cultures
Nikit Patel 13:37, 8 March 2011 (EST)
Thought of the day: I want Sergey to add me on Words with Friends!
- Performed Analytical Mapping Digests on all 8 minipreps
- Ran the digested products on a gel (below)
- - Lane #5 : sbb1104 #1
- - Lane #6 : sbb1104 #2
- - Lane #7 : sbb1104 #3
- - Lane #8 : sbb1104 #4
- - Lane #9 : sbb1124 #1
- - Lane #10 : sbb1124 #2
- - Lane #11 : sbb1124 #3
- - Lane #12 : sbb1124 #4
Nikit Patel 13:00, 10 March 2011 (EST)
Thought of the day: BioE 100 midterm is stealing my mind away from BioE 140L midterm!
- Lane 11 doesn't look good.
- Therefore, we will be putting in sbb1104 #1/2 and sbb1124 #1/2 for sequencing