SBB11Ntbk-James Macaulay
From OpenWetWare
James Macaulay 13:23, 15 February 2011 (EST)
Construction of composite part red/recA basic part sbb1142 Digest sbb1142 from pBca9145-jtk2979 (EcoRI/BamHI, 3287+2057, L) Sub into pBca1766 (3287bp, EcoRI/BamHI) Product is pBca1766-sbb1142 [red/recA]
Bglbrick Construction of P_hdeAB basic part sbb1128 PCR jm50f/jm51r on MG1655 genomic DNA (431bp, EcoRI/BamHI) Sub into pBjh1601KC (Bglbrick vector: 3140bp) Product is pBjh1601KC-sbb1150 [P_hdeAB] ------ jm50f Forward cloning of P_hdeAB Bglbrick basic part CGATAGAATTCATGAGATCTTAAGAAGAAAATCCCCTGC jm51r Reverse cloning of P_hdeAB Bglbrick basic part CCATTGGATCCCCAACTGCAGTTGGCTGG
- Set up PCR for part sbb1142 with 2K55 protocol.
James Macaulay 13:44, 17 February 2011 (EST)
- Set up an analytical gel for part sbb1142, which I renamed as jm54 to differentiate from the mass of other parts with the sbb prefix.
- No visible bands showed up, need to set up new PCR.
- New PCR setup:
- jm54-W
- PCR_Protocol -- 2k45 PCR cycle
- jm54-D
- PCR_Protocol -3.3µL ddH20 + 3.3µL DMSO. -- 2k45 PCR cycle
- New PCR setup:
- No visible bands showed up, need to set up new PCR.
- Set up a digest of pBca9145-jtk2979 with EcoRI/BamHI.
- Used 5µL of PCR product to be digested instead of 8µL.
James Macaulay 16:25, 18 February 2011 (EST)
- Submitted an analytical gel for jm54-W and jm54-D, re-PCR'd from previous day.
- Looking for 431 bp bands in lanes 1 and 2:
- Successful? Y
- - Since successful, moving on to perform regular zymo cleanup.
- Performed a Zymo Gel Purification for part jtk2979, labeled JAM jtk zymo and placed in Box C.
James Macaulay 13:10, 22 February 2011 (EST)
To do today:
- Digest PCR Products
- Excise out band in lane1 (431 bp)
then Gel Purify, then ligate. The ligation step will probably be saved until Thursday (2/24).
- The cut-and-paste part, jtk2979 needs to be redone because the AW buffer was used instead of A4 buffer. We need to re-digest and gel-prep.
James Macaulay 13:50, 24 February 2011 (EST)
- Zymo Gel purification of part sbb1128. Placed in box A labeled "JM28 pur 24".
- Used 8µL for DNA preparatory gel
- 28 refers to the part number suffix, 24 refers to the day last manipulated, eg., 2/24.
- Eco/Bam digest of pBca9145-jtk2979, only had 4µL of DNA, so replaced the other 4µL with ddH2O.
- Performed preparatory gel, and now need to do gel purification.
- Note
- Used 4µL of DNA for digestion, so ELUTE using 4µL ddH2O in final step of zymo purification.
- labeled: , and placed in box: