SBB11Ntbk-James Macaulay: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
Line 66: Line 66:
:Used 4µL of DNA for digestion, so '''ELUTE''' using 4µL ddH2O when performing final step of zymo purification.
:Used 4µL of DNA for digestion, so '''ELUTE''' using 4µL ddH2O when performing final step of zymo purification.
:labeled: JM2979, and placed in box: A
:labeled: JM2979, and placed in box: A
== [[User:James M MacAulay|jamesmmacaulay@gmail.com]] 12:46, 1 March 2011 (EST) ==
All cell parts go into "Lefty comp cells"

Revision as of 10:46, 1 March 2011

James Macaulay 13:23, 15 February 2011 (EST)

Construction of composite part red/recA basic part sbb1142
Digest sbb1142 from pBca9145-jtk2979	(EcoRI/BamHI, 3287+2057, L)
Sub into pBca1766					(3287bp, EcoRI/BamHI)
Product is pBca1766-sbb1142			[red/recA]
Bglbrick Construction of P_hdeAB basic part sbb1128
PCR jm50f/jm51r on MG1655 genomic DNA (431bp, EcoRI/BamHI)
Sub into pBjh1601KC			(Bglbrick vector: 3140bp)
Product is pBjh1601KC-sbb1150	[P_hdeAB]
------
jm50f Forward cloning of P_hdeAB Bglbrick basic part
CGATAGAATTCATGAGATCTTAAGAAGAAAATCCCCTGC
jm51r Reverse cloning of P_hdeAB Bglbrick basic part
CCATTGGATCCCCAACTGCAGTTGGCTGG
  • Set up PCR for part sbb1142 with 2K55 protocol.

James Macaulay 13:44, 17 February 2011 (EST)

  • Set up an analytical gel for part sbb1142, which I renamed as jm54 to differentiate from the mass of other parts with the sbb prefix.
    • No visible bands showed up, need to set up new PCR.
  • Set up a digest of pBca9145-jtk2979 with EcoRI/BamHI.
    • Used 5µL of PCR product to be digested instead of 8µL.

James Macaulay 16:25, 18 February 2011 (EST)

  • Submitted an analytical gel for jm54-W and jm54-D, re-PCR'd from previous day.
    • Looking for 431 bp bands in lanes 1 and 2:
Successful? Y
- Since successful, moving on to perform regular zymo cleanup.

James Macaulay 13:10, 22 February 2011 (EST)

To do today:

  • Digest PCR Products
  • Excise out band in lane1 (431 bp)

then Gel Purify, then ligate. The ligation step will probably be saved until Thursday (2/24).

  • The cut-and-paste part, jtk2979 needs to be redone because the AW buffer was used instead of A4 buffer. We need to re-digest and gel-prep.

James Macaulay 13:50, 24 February 2011 (EST)

Zymo Gel purification of part sbb1128.


  • Used 8µL for DNA preparatory gel.
  • Placed in box A
  • labeled "JM28 pur 24".
    • JM=initials, 28 refers to the part number suffix, 24 refers to the day last manipulated, eg., 2/24.

EcoRI/BamHI digest of pBca9145-jtk2979


  1. Only had 4µL of DNA, so replaced the other 4µL with ddH2O.
  2. Gel purification My sample is placed in lane 2
  3. Looking for 3287bp segment of the digestion.
Notes for next time
Used 4µL of DNA for digestion, so ELUTE using 4µL ddH2O when performing final step of zymo purification.
labeled: JM2979, and placed in box: A


jamesmmacaulay@gmail.com 12:46, 1 March 2011 (EST)

All cell parts go into "Lefty comp cells"