SBB11Ntbk-James Macaulay

James Macaulay 13:23, 15 February 2011 (EST)

Construction of composite part red/recA basic part sbb1142
Digest sbb1142 from pBca9145-jtk2979	(EcoRI/BamHI, 3287+2057, L)
Sub into pBca1766					(3287bp, EcoRI/BamHI)
Product is pBca1766-sbb1142			[red/recA]

Bglbrick Construction of P_hdeAB basic part sbb1128
PCR jm50f/jm51r on MG1655 genomic DNA (431bp, EcoRI/BamHI)
Sub into pBjh1601KC			(Bglbrick vector: 3140bp)
Product is pBjh1601KC-sbb1150	[P_hdeAB]
------
jm50f Forward cloning of P_hdeAB Bglbrick basic part
CGATAGAATTCATGAGATCTTAAGAAGAAAATCCCCTGC
jm51r Reverse cloning of P_hdeAB Bglbrick basic part
CCATTGGATCCCCAACTGCAGTTGGCTGG

• Set up PCR for part sbb1142 with 2K55 protocol.

James Macaulay 13:44, 17 February 2011 (EST)

• Set up an analytical gel for part sbb1142, which I renamed as jm54 to differentiate from the mass of other parts with the sbb prefix.
  • No visible bands showed up, need to set up new PCR.
    • New PCR setup:

      jm54-W

      PCR_Protocol -- 2k45 PCR cycle

      jm54-D

      PCR_Protocol -3.3µL ddH20 + 3.3µL DMSO. -- 2k45 PCR cycle

• Set up a digest of pBca9145-jtk2979 with EcoRI/BamHI.
  • Used 5µL of PCR product to be digested instead of 8µL.

James Macaulay 16:25, 18 February 2011 (EST)

• Submitted an analytical gel for jm54-W and jm54-D, re-PCR'd from previous day.
  • Looking for 431 bp bands in lanes 1 and 2:

Successful? Y

- Since successful, moving on to perform regular zymo cleanup.

• Performed a Zymo Gel Purification for part jtk2979, labeled JAM jtk zymo and placed in Box C.

James Macaulay 13:10, 22 February 2011 (EST)

To do today:

• Digest PCR Products
• Excise out band in lane1 (431 bp)
  

then Gel Purify, then ligate. The ligation step will probably be saved until Thursday (2/24).

• The cut-and-paste part, jtk2979 needs to be redone because the AW buffer was used instead of A4 buffer. We need to re-digest and gel-prep.

jamesmmacaulay@gmail.com 13:50, 24 February 2011 (EST)

• Performed Zymo Gel purification of part sbb1128. Placed in box A labeled "JM28 pur 24".

- Used 8µL for DNA preparatory gel

• • 28 refers to the part number suffix, 24 refers to the day last manipulated, eg., 2/24.

• Eco/Bam digest of pBca9145-jtk2979, only had 4µL of DNA, so replaced the other 4µL with ddH2O.
  • Performed preparatory gel, and now need to do gel purification.

Note

Used 4µL of DNA for digestion, so ELUTE using 4µL ddH2O in final step of zymo purification.

labeled: , and placed in box: