SBB11Ntbk-James Macaulay: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Line 43: | Line 43: | ||
== [[User:James M MacAulay|James Macaulay]] 13:10, 22 February 2011 (EST) == | == [[User:James M MacAulay|James Macaulay]] 13:10, 22 February 2011 (EST) == | ||
To do today: | To do today: | ||
* [http://openwetware.org/wiki/Template:SBB-Protocols_Enz2 Digest] PCR Products | * [http://openwetware.org/wiki/Template:SBB-Protocols_Enz2 Digest] PCR Products | ||
* Excise out band in lane1 (431 bp) | |||
then [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Gel Purify], then [http://openwetware.org/wiki/Template:SBB-Protocols_Enz4 ligate]. The ligation step will probably be saved until Thursday (2/24). | |||
* The cut-and-paste part, jtk2979 needs to be redone because the AW buffer was used instead of A4 buffer. We need to re-digest and gel-prep. | * The cut-and-paste part, jtk2979 needs to be redone because the AW buffer was used instead of A4 buffer. We need to re-digest and gel-prep. |
Revision as of 12:54, 22 February 2011
James Macaulay 13:23, 15 February 2011 (EST)
Construction of composite part red/recA basic part sbb1142 Digest sbb1142 from pBca9145-jtk2979 (EcoRI/BamHI, 3287+2057, L) Sub into pBca1766 (3287bp, EcoRI/BamHI) Product is pBca1766-sbb1142 [red/recA]
Bglbrick Construction of P_hdeAB basic part sbb1128 PCR jm50f/jm51r on MG1655 genomic DNA (431bp, EcoRI/BamHI) Sub into pBjh1601KC (Bglbrick vector: 3140bp) Product is pBjh1601KC-sbb1150 [P_hdeAB] ------ jm50f Forward cloning of P_hdeAB Bglbrick basic part CGATAGAATTCATGAGATCTTAAGAAGAAAATCCCCTGC jm51r Reverse cloning of P_hdeAB Bglbrick basic part CCATTGGATCCCCAACTGCAGTTGGCTGG
- Set up PCR for part sbb1142 with 2K55 protocol.
James Macaulay 13:44, 17 February 2011 (EST)
- Set up an analytical gel for part sbb1142, which I renamed as jm54 to differentiate from the mass of other parts with the sbb prefix.
- No visible bands showed up, need to set up new PCR.
- New PCR setup:
- jm54-W
- PCR_Protocol -- 2k45 PCR cycle
- jm54-D
- PCR_Protocol -3.3µL ddH20 + 3.3µL DMSO. -- 2k45 PCR cycle
- New PCR setup:
- No visible bands showed up, need to set up new PCR.
- Set up a digest of pBca9145-jtk2979 with EcoRI/BamHI.
- Used 5µL of PCR product to be digested instead of 8µL.
James Macaulay 16:25, 18 February 2011 (EST)
- Submitted an analytical gel for jm54-W and jm54-D, re-PCR'd from previous day.
- Looking for 431 bp bands in lanes 1 and 2:
- Successful? Y
- - Since successful, moving on to perform regular zymo cleanup.
- Performed a Zymo Gel Purification for part jtk2979, labeled JAM jtk zymo and placed in Box C.
James Macaulay 13:10, 22 February 2011 (EST)
To do today:
- Digest PCR Products
- Excise out band in lane1 (431 bp)
then Gel Purify, then ligate. The ligation step will probably be saved until Thursday (2/24).
- The cut-and-paste part, jtk2979 needs to be redone because the AW buffer was used instead of A4 buffer. We need to re-digest and gel-prep.