SBB10Ntbk-ZhenZongHuang

Zhen Z. Huang 16:05, 17 February 2010 (EST)

Wed, Feb 17th, 2010

I prepared a PCR reaction for sbb31 and a wobble reaction for sbb15.

sbb31

I made The oligo concentrations of 100uM for ZHH001 and ZHH002 by adding the right amount of DDH20. Then I made oligo dilution of with 9uL Water and 1uL 100uM of the oligos to make 10uM.

I added the following into a PCR tube in the following order: 24uL ddH2O 3.3uL 10x Expand Buffer "2" 3.3uL dNTPs (2mM in each) 1uL Oligo 1, 10uM 1uL Oligo 2, 10uM 0.5uL Expand polymerase "1" 0.5uL Template DNA

I put the the PCR tube in the 2K55 ice bucket.

sbb15

I added the following into a PCR tube in the following order: 29 uL water 5 uL Expand 10x Buffer 2 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc) 5 uL Oligo 1 (100uM) 5 uL Oligo 2 (100uM) 0.75 uL Expand Polymerase 1

I made The oligo concentrations of 100uM for ZHH003 and ZHH004 by adding the right amount of DDH20

I put the resulting wobble PCR tube in the 2k55 ice bucket.

Zhen Z. Huang 15:05, 16 February 2010 (EST)

sbb31

1. PCR
2. Analytical gel
3. Regular Zymol Clean up
4. EcoR1/BamH1 Digest of PCR Product
5. Zymol Gel Purification
6. Ligation of EcoR1/BamH1 Digest
7. Mapping
8. Zymol Gel Purification

sbb15

1. Wobble
2. Small Zymol Clean up
3. EcoR1/BamH1 Digest of Wobble Product
4. Zymol Gel Purification
5. Ligation of EcoR1/BamH1 Digest
6. Mapping
7. Zymol Gel Purification

Construction Files for my parts

sbb31

sbb31: CA42 origin of replication
Source:  pEC22-CA42
Target Sequence:  agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatagcctatatcagataacagcgcctttctggcgtttttttgagcagtaggtcttttgccg
Vector:  pBjk2741
Short description: oriCA42
Genbank reference: D30056.1 
Family:  Origin of Replication

PCR ZZH001 and ZZH002 on pEC22-CA42  (547 bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144             (EcoRI/BamHI, 2472+910, L)
Product is pBca9523-sbb31         {oriCA42}
----------------------------
ZZH001   Forward oligo for cloning of oriCA42   
ccataGAATTCatgAGATCTagcacttcagcgcgccgtag
ZZh002   Reverse oligo for cloning of oriCA42    
ctgatGGATCCcggcaaaagacctactgctc

sbb15

sbb15: phiC31 attB
Source:  Synthetic
Target Sequence:  tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca
Vector:  pBjk2741
Short descriptions: phiC31 attB
Genbank reference: AB306970 (759…842) 
Family:  Phage att site

good 20 bp gtgccagggcgtgcccttgg

Wobble ZZH003/ZZH004            (115bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144         (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sbb15     {phiC31 attB}
----
ZZH003   Forward construction of phiC31 attB basic part
ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgg
ZZH004   Reverse construction of phiC31 attB basic part
ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcac