SBB10Ntbk-ZhenZongHuang: Difference between revisions
No edit summary |
No edit summary |
||
Line 10: | Line 10: | ||
#Sbb15 -- Small Zymol Clean up | #Sbb15 -- Small Zymol Clean up | ||
Because I forgot to label the tubes, I do not know which one is SBB15 and which one is SBB31. Need to run gel to figure out which one is which. | Because I forgot to label the tubes, I do not know which one is SBB15 and which one is SBB31. Need to run gel to figure out which one is which. | ||
SBB31 and SSB15 are switched. [http://openwetware.org/wiki/SBB10Ntbk-ChrisAnderson gel results]. | |||
SBB31 and SBB15 are stored in Box B. | |||
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 16:05, 17 February 2010 (EST)== | ==[[User:Zhen Zong Huang|Zhen Z. Huang]] 16:05, 17 February 2010 (EST)== |
Revision as of 14:16, 24 February 2010
Zhen Z. Huang 13:30, 22 February 2010 (EST)
I prepared analytical gel for sbb31.
It looks like about 500 bps. The expected product is 547 bp. This looks like the right product.
- Sbb31 -- Zymol Clean up
- Sbb15 -- Small Zymol Clean up
Because I forgot to label the tubes, I do not know which one is SBB15 and which one is SBB31. Need to run gel to figure out which one is which.
SBB31 and SSB15 are switched. gel results.
SBB31 and SBB15 are stored in Box B.
Zhen Z. Huang 16:05, 17 February 2010 (EST)
Wed, Feb 17th, 2010
I prepared a PCR reaction for sbb31 and a wobble reaction for sbb15.
sbb31
Regular PCR
I made The oligo concentrations of 100uM for ZHH001 and ZHH002 by adding the right amount of DDH20. Then I made oligo dilution of with 9uL Water and 1uL 100uM of the oligos to make 10uM.
I added the following into a PCR tube in the following order:
- 24uL ddH2O
- 3.3uL 10x Expand Buffer "2"
- 3.3uL dNTPs (2mM in each)
- 1uL Oligo 1, 10uM
- 1uL Oligo 2, 10uM
- 0.5uL Expand polymerase "1"
- 0.5uL Template DNA
I put the the PCR tube in the 2K55 ice bucket.
sbb15
Wobble
I made The oligo concentrations of 100uM for ZHH003 and ZHH004 by adding the right amount of DDH20
I added the following into a PCR tube in the following order:
- 29 uL water
- 5 uL Expand 10x Buffer 2
- 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc)
- 5 uL Oligo 1 (100uM)
- 5 uL Oligo 2 (100uM)
- 0.75 uL Expand Polymerase 1
I put the resulting wobble PCR tube in the 2k55 ice bucket.
Zhen Z. Huang 15:05, 16 February 2010 (EST)
Planning for Wed, Feb 17th, 2010
sbb31
- PCR
- Analytical gel
- Regular Zymol Clean up
- EcoR1/BamH1 Digest of PCR Product
- Zymol Gel Purification
- Ligation of EcoR1/BamH1 Digest
- Mapping
- Zymol Gel Purification
sbb15
- Wobble
- Small Zymol Clean up
- EcoR1/BamH1 Digest of Wobble Product
- Zymol Gel Purification
- Ligation of EcoR1/BamH1 Digest
- Mapping
- Zymol Gel Purification
Zhen Z. Huang 13:00, 18 February 2010 (EST)
Construction Files for my parts
sbb31
sbb31: CA42 origin of replication Source: pEC22-CA42 Target Sequence: agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatagcctatatcagataacagcgcctttctggcgtttttttgagcagtaggtcttttgccg Vector: pBjk2741 Short description: oriCA42 Genbank reference: D30056.1 Family: Origin of Replication PCR ZZH001 and ZZH002 on pEC22-CA42 (547 bp, EcoRI/BamHI) Sub into pBjk2741-Bca1144 (EcoRI/BamHI, 2472+910, L) Product is pBca9523-sbb31 {oriCA42} ---------------------------- ZZH001 Forward oligo for cloning of oriCA42 ccataGAATTCatgAGATCTagcacttcagcgcgccgtag ZZh002 Reverse oligo for cloning of oriCA42 ctgatGGATCCcggcaaaagacctactgctc
sbb15
sbb15: phiC31 attB Source: Synthetic Target Sequence: tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca Vector: pBjk2741 Short descriptions: phiC31 attB Genbank reference: AB306970 (759…842) Family: Phage att site good 20 bp gtgccagggcgtgcccttgg Wobble ZZH003/ZZH004 (115bp, EcoRI/BamHI) Sub into pBjk2741-Bca1144 (EcoRI/BamHI, 2170+910, L) Product is pBjk2741-sbb15 {phiC31 attB} ---- ZZH003 Forward construction of phiC31 attB basic part ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgg ZZH004 Reverse construction of phiC31 attB basic part ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcac