SBB10Ntbk-ZhenZongHuang: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 1: Line 1:
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 16:05, 17 February 2010 (EST)==
===Wed, Feb 17th, 2010===
===sbb31===
I did the PCR protocol for sbb31 in 2k55.
===sbb15===
I did the Wobble protocol for sbb15 in 2k55.
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:05, 16 February 2010 (EST)==
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:05, 16 February 2010 (EST)==
===Planning for Wed, Feb 17th, 2010===
===Planning for Wed, Feb 17th, 2010===

Revision as of 17:17, 17 February 2010

Zhen Z. Huang 16:05, 17 February 2010 (EST)

Wed, Feb 17th, 2010

sbb31

I did the PCR protocol for sbb31 in 2k55.

sbb15

I did the Wobble protocol for sbb15 in 2k55.


Zhen Z. Huang 15:05, 16 February 2010 (EST)

Planning for Wed, Feb 17th, 2010

sbb31

  1. PCR
  2. Analytical gel
  3. Regular Zymol Clean up
  4. EcoR1/BamH1 Digest of PCR Product
  5. Zymol Gel Purification
  6. Ligation of EcoR1/BamH1 Digest
  7. Mapping
  8. Zymol Gel Purification

sbb15

  1. Wobble
  2. Small Zymol Clean up
  3. EcoR1/BamH1 Digest of Wobble Product
  4. Zymol Gel Purification
  5. Ligation of EcoR1/BamH1 Digest
  6. Mapping
  7. Zymol Gel Purification

Zhen Z. Huang 13:00, 18 February 2010 (EST)

Construction Files for my parts

sbb31

sbb31: CA42 origin of replication
Source:  pEC22-CA42
Target Sequence:  agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatagcctatatcagataacagcgcctttctggcgtttttttgagcagtaggtcttttgccg
Vector:  pBjk2741
Short description: oriCA42
Genbank reference: D30056.1 
Family:  Origin of Replication

PCR ZZH001 and ZZH002 on pEC22-CA42  (547 bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144             (EcoRI/BamHI, 2472+910, L)
Product is pBca9523-sbb31         {oriCA42}
----------------------------
ZZH001   Forward oligo for cloning of oriCA42   
ccataGAATTCatgAGATCTagcacttcagcgcgccgtag
ZZh002   Reverse oligo for cloning of oriCA42    
ctgatGGATCCcggcaaaagacctactgctc


sbb15

sbb15: phiC31 attB
Source:  Synthetic
Target Sequence:  tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca
Vector:  pBjk2741
Short descriptions: phiC31 attB
Genbank reference: AB306970 (759…842) 
Family:  Phage att site

good 20 bp gtgccagggcgtgcccttgg

Wobble ZZH003/ZZH004            (115bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144         (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sbb15     {phiC31 attB}
----
ZZH003   Forward construction of phiC31 attB basic part
ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgg
ZZH004   Reverse construction of phiC31 attB basic part
ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcac