SBB10Ntbk-BenBubenheim

From OpenWetWare

Revision as of 16:57, 31 March 2010 by Ben D. Bubenheim (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

My Project
My Personal Page
My Group Project Notebook
My Group Prompt

Contents

Construction Files

sbb01: N15 Protelomerase

Construction of sbb01: N15 Protelomerase

PCR BDBn15001F/BDBn15001R on Bca1455		(942 bp, gp=A)
PCR BDBn15002F/BDBn15002R on Bca1485		(1020 bp, gp=B)
--------------------------------------------------------------
PCR BDBn15001F/BDBn15002R on A+B		(1924 bp, EcoR1/BamH1)
Sub in pBjk2741-Bca1144				(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb01	{rbs.part!}

BDBn15001F	Forward retrieval, RBS introduction and BioBricking on Bca1455
CCATAgaattcATGagatctTCAATCTCGGAGGAACGGTAAGGAAGGAAAACatgAGCAAGGTAAAAATCGGTGAG
BDBn15001R	Reverse retrieval and SOE-site introduciton on Bca1455
CGCTTTTATCTTCACTGCGTTTTTTAGCTTGCCCTGAG
BDBn15002F	Forward retrieval and SOE-site introduciton on Bca1485
CTCAGGGCAAGCTAAAAAACGCAGTGAAGATAAAAGCG
BDBn15002R	Reverse retrieval and BioBricking on Bca1485
CTGATggatccGCTGTAGTACGTTTCCCATGCGG


JCA Notes

  • got 974 for first pcr
  • No stop codon on BDBn15002R
  • Otherwise correct
  • replaced first oligo with shorter, it's pressing your luck to use an oligo that long for soeing
  • May need to alter this one based on PCR results
Construction of sbb01: N15 Protelomerase

PCR BDBn15001F/CA1472 on Bca1455 1-3          (595bp, gp=A)
PCR ca1461/BDBn15001R on Bca1455 1-1          (762bp, gp=B)
PCR BDBn15002F/BDBn15002R on Bca1485 2-1      (1023 bp, gp=C)
--------------------------------------------------------------
PCR BDBn15001F/BDBn15002R on A+B+C		(1950 bp, EcoR1/BamH1)
Sub in pBjk2741-Bca1144				(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb01	{rbs.part!}

BDBn15001F	Forward retrieval, RBS introduction and BioBricking on Bca1455
CCATAgaattcATGagatctGAGGAACGGTAAGGAAGGAAAACatgAGCAAGGTAAAAATCGG
CA1461	GGAAAGGATTGCAGAAAAGAATAACCGCGAATACTTTTAACGCCTATATGA
PCA assembly of protelomerasefiveprime (Bca1455)
CA1472	TTGTTGGAATAACTTATAAAGATAGTCACGGCGCTCCTTCCAATCATCACT
PCA assembly of protelomerasefiveprime (Bca1455)
BDBn15001R	Reverse retrieval and SOE-site introduciton on Bca1455
CGCTTTTATCTTCACTGCGTTTTTTAGCTTGCCCTGAG
BDBn15002F	Forward retrieval and SOE-site introduciton on Bca1485
CTCAGGGCAAGCTAAAAAACGCAGTGAAGATAAAAGCG
BDBn15002R	Reverse retrieval and BioBricking on Bca1485
CTGATggatccttaGCTGTAGTACGTTTCCCATGCGG

part:  gatctGAGGAACGGTAAGGAAGGAAAACatgAGCAAGGTAAAAATCGGTGAGTTGATCAACACGCTTGTGAATGAGGTAGAGGCCATTGATGCCTCAGACCGCCCACAAGGCGACAAAACGAAGAGAATTAAAGCCGCAGCCGCACGGTATAAGAACGCGTTATTTAATGATAAAAGAAAGTTCCGTGGGAAAGGATTGCAGAAAAGAATAACCGCGAATACTTTTAACGCCTATATGAGCAGGGCAAGAAAGCGGTTTGATGATAAATTACATCATAGCTTTGATAAAAATATTAATAAATTATCGGAAAAGTATCCTCTTTACAGCGAAGAATTATCTTCATGGCTTTCTATGCCTACGGCTAATATTCGCCAGCACATGTCATCGTTACAATCTAAATTGAAAGAAATAATGCCGCTTGCCGAAGAGTTATCAAATGTAAGAATAGGCTCTAAAGGCAGTGATGCAAAAATAGCAAGACTAATAAAAAAATATCCAGATTGGAGTTTTGCTCTTAGTGATTTAAACAGTGATGATTGGAAGGAGCGCCGTGACTATCTTTATAAGTTATTCCAACAAGGCTCTGCGTTGTTAGAAGAACTACACCAGCTCAAGGTCAACCATGAGGTTCTGTACCATCTCCAGCTAAGCCCTGCGGAGCGTACATCTATACAGCAACGATGGGCCGATGTTCTGCGCGAGAAGAAGCGTAATGTTGTGGTTATTGACTACCCAACATACATGCAGTCTATCTATGATATTTTGAATAATCCTGCGACTTTATTTAGTTTAAACACTCGTTCTGGAATGGCACCTTTGGCCTTTGCTCTGGCTGCGGTATCAGGGCGAAGAATGATTGAGATAATGTTTCAGGGTGAATTTGCCGTTTCAGGAAAGTATACGGTTAATTTCTCAGGGCAAGCTAAAAAACGCAGTGAAGATAAAAGCGTAACCAGAACGATTTATACTTTATGCGAAGCAAAATTATTCGTTGAATTATTAACAGAATTGCGTTCTTGCTCTGCTGCATCTGATTTCGATGAGGTTGTTAAAGGATATGGAAAGGATGATACAAGGTCTGAGAACGGCAGGATAAATGCTATTTTAGCAAAAGCATTTAACCCTTGGGTTAAATCATTTTTCGGCGATGACCGTCGTGTTTATAAAGATAGCCGCGCTATTTACGCTCGCATCGCTTATGAGATGTTCTTCCGCGTCGATCCACGGTGGAAAAACGTCGACGAGGATGTGTTCTTCATGGAGATTCTCGGACACGACGATGAGAACACCCAGCTGCACTATAAGCAGTTCAAGCTGGCCAACTTTTCCAGAACCTGGCGACCGGAAGTTGGGGATGAAAACACCAGGCTGGTGGCTCTCCAGAAACTGGACGATGAAATGCCAGGCTTTGCCAGAGGTGACGCTGGCGTCCGTCTCCATGAAACCGTTAAGCAGCTGGTGGAGCAGGACCCATCAGCAAAAATAACCAACAGCACTCTCCGGGCCTTTAAATTTAGCCCGACGATGATTAGCCGGTACCTGGAGTTTGCCGCTGATGCATTGGGGCAGTTCGTTGGCGAGAACGGGCAGTGGCAGCTCAAGATAGAGACACCTGCAATCGTCCTGCCTGATGAAGAATCCGTTGAGACCATCGACGAACCGGATGATGAGTCCCAAGACGACGAGCTGGATGAAGATGAAATTGAGCTCGACGAGGGTGGCGGCGATGAACCAACCGAAGAGGAAGGGCCAGAAGAACATCAGCCAACTGCTCTAAAACCCGTCTTCAAGCCTGCAAAAAATAACGGGGACGGAACGTACAAGATAGAGTTTGAATACGATGGAAAGCATTATGCCTGGTCCGGCCCCGCCGATAGCCCTATGGCCGCAATGCGATCCGCATGGGAAACGTACTACAGCTAAG


sbb05: piggieBac 5'TR

Construction of sbb05: piggieBac 5'TR

Pool BDBpb001 through BDBpb010, assemble by PCA
PCR BDBpb001/BDBpb010 on PCA reaction	(344 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb05

------------

BDBpb001	PCA assembly of sbb11	CCATAGAATTCATGAGATCTTTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGC
BDBpb002	PCA assembly of sbb11	GCTATTTAGAAAGAGAGAGCAATATTTCAAGAATGCATGCGTCAATTTTACGCAGACTATC
BDBpb003	PCA assembly of sbb11	GAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGG
BDBpb004	PCA assembly of sbb11	CTCACGGGAGCTCCAAGCGGCGACTGAGATGTCCTAAATGCACAGCGACGGA
BDBpb005	PCA assembly of sbb11	CGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGTGTCACTGATTTTGA
BDBpb006	PCA assembly of sbb11	CGTCATTTTGACTCACGCGGTCGTTATAGTTCAAAATCAGTGACACTTACCGC
BDBpb007	PCA assembly of sbb11	CCGCGTGAGTCAAAATGACGCATGATTATCTTTTACGTGACTTTTAAGATTTAACTCATACG
BDBpb008	PCA assembly of sbb11	TATCACGTAAGTAGAACATGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGT
BDBpb009	PCA assembly of sbb11	ATATTGTTATTTCATGTTCTACTTACGTGATAACTTATTATATATATATTTTCTTGTTATAGATATCGGATC
BDBpb010	PCA assembly of sbb11	CTGATGGATCCGATATCTATAACAAGAAAATATATATATAATAA

JCA Notes

  • Correct


Part Assembly

2/17/2010

sbb01

  • Diluted original oligo stock from 100uM to 10uM (in separate tubes) as required by the protocol.
  • Set up 3 PCR's as per Cloning by PCR with oligos:
  1. BDBn15001F/CA1472 on Bca1455 1-3 (A)
  2. ca1461/BDBn15001R on Bca1455 1-1 (B)
  3. BDBn15002F/BDBn15002R on Bca1485 2-1 (C)
24uL ddH2O
3.3uL 10x Expand Buffer "2"
3.3uL dNTPs (2mM in each)
1uL Oligo 1, 10uM
1uL Oligo 2, 10uM
0.5uL Expand polymerase "1"
0.5uL Template DNA
  • Left labeled tubes for GSI's to put into the thermocycler for 2k55 program

sbb05

  • Set up PCA assembly step as per PCA Gene Synthesis with the oligos in the sbb05 construction file
PCA assembly protocol

   1. 38 uL ddH2O
   2. 5 ul 10x expand buffer
   3. 5 ul 2mM dNTPs
   4. 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
   5. 0.75 ul Expand polymerase 

Program (can run JCA/PCA1)

   1. 2 min initial denature at 94oC
   2. 30 sec denature at 94oC
   3. 30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed]
   4. 30 sec extension at 72oC
   5. repeat 2-4 30 times total 
  • GSI's ran thermocycler

2/22/2010

sbb01

  • set up PCR products A, B, and C for preparative gel.
    • 6uL PCR product + 4uL loading buffer
  • The gel with my samples was run by Amy.

Image:AK_02_22_10.jpgImage:Generuler1kbplus.jpg

  • My PCR products (lanes 7, 8 , 9) appear to be the correct sizes.
  • GSI's cut out my bands and melted them in 650uL ADB buffer as per the first step in SOEing PCR

sbb05

  • Performed Small-frag Zymo Cleanup to purify PCA Assembly.
   1. Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction.
   2. Transfer into the Zymo column (small clear guys)
   3. Add 500uL of Ethanol and pipette up and down to mix
   4. spin through, discard waste.
   5. Add 200 uL of PE or Zymo Wash buffer (which is basically 70% ethanol)
   6. spin through, discard waste.
   7. Add 200 uL of PE or Zymo Wash buffer
   8. spin through, discard waste.
   9. spin for 90 seconds, full speed to dry.
  10. elute with water into a fresh Eppendorf tube
  • With eluted product, set up amplification PCR
Recipe

   1. 1 ul each outer oligo (10 uM)
   2. .5 ul phusion
   3. 10 ul 5x phusion buffer
   4. 5 ul 2mM dNTPs
   5. 32.5 ul H2O 

Program

   1. 2 min initial denature at 94oC
   2. 30 sec denature at 94oC
   3. 30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product]
   4. 30 sec extension at 68oC
   5. repeat 2-4 30 times total 
  • GSI's ran PCR program

2/24/2010

sbb01

All spins until the drying step are 15 second full speed spins. 

   1. cut out bands minimizing extra gel matter.
   2. put in ependorf tube and add 600uL of Zymo ADB buffer (brown bottle).
   3. heat at 55, shake and/or vortex until the gel has dissolved.
   4. If the DNA is <300bp add 250uL of isopropanol
   5. transfer into the Zymo column inside a collection tube (small clear guys)
   6. spin through, discard waste.
   7. Add 200 uL of PE buffer (which is basically 70% ethanol)
   8. spin through, discard waste.
   9. Add 200 uL of PE buffer
  10. spin through, discard waste.
  11. spin for 90 seconds, full speed to dry.
  12. elute with 8.5 uL of water into a fresh Eppendorf tube 
24uL ddH2O
3.3uL 10x Expand Buffer "2"
3.3uL dNTPs (2mM in each)
1uL Oligo 1, 10uM
1uL Oligo 2, 10uM
0.5uL Expand polymerase "1"
0.5uL Template DNA
  • 2K55 program was used again.

sbb05

  • Amplification product was retrieved and prepared for an analytical gel.
    • 3uL PCR product + 7uL loading buffer
  • Michel ran this gel.

Image:MN022410.png

  • My amplification product was in lane 2, and the band corresponded to the correct length.

3/1/2010

sbb01

  • Prepared PCR product for analytical gel.
    • 3uL PCR product + 7 uL loading buffer

Image:MN030110.jpg

  • My sample is in the 5th lane. It looks good, although there is another band that looks like it is an incomplete fragment (A+B or B+C).
  • Cleaned up the PCR product using a Regular Zymo Cleanup.

sbb05

 8uL of eluted PCR product
 1uL of NEB Buffer 2
 0.5uL EcoRI
 0.5uL BamHI
  • Incubated at 37°C for an hour.
  • Prepared digest for analytical gel
    • 10 uL digest + 1 uL 6x Loading Buffer

Image:BB_3.01.10.jpg

  • Ran the gel by myself, the band looks good

3/3/10

sbb01

  • Prepared my PCR product for an Eco/Bam digestion by setting up the following reaction:
 8uL of eluted PCR product
 1uL of NEB Buffer 2
 0.5uL EcoRI
 0.5uL BamHI
  • Incubated at 37°C for an hour.
  • Prepared digest for preparative gel
    • 10 uL digest + 1 uL 6x Loading Buffer

Image:MN030310Agel.png

  • My digest is in lane 3. It looks good.
  • Cut out the gel and dropped it into an Eppendorf tube.
  • Added 600 uL ADB buffer and melted the gel at 55°C
  • Performed a Zymo Gel Purification:
    * All spins until the drying step are 15 second full speed spins. 

   1. cut out bands minimizing extra gel matter.
   2. put in ependorf tube and add 600uL of Zymo ADB buffer (brown bottle).
   3. heat at 55, shake and/or vortex until the gel has dissolved.
   4. If the DNA is <300bp add 250uL of isopropanol
   5. transfer into the Zymo column inside a collection tube (small clear guys)
   6. spin through, discard waste.
   7. Add 200 uL of PE buffer (which is basically 70% ethanol)
   8. spin through, discard waste.
   9. Add 200 uL of PE buffer
  10. spin through, discard waste.
  11. spin for 90 seconds, full speed to dry.
  12. elute with 8.5 uL of water into a fresh Eppendorf tube 

sbb05

Set up the following reaction:
  6.5uL ddH2O
  1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
  1uL Vector digest
  1uL Insert digest
  0.5uL T4 DNA Ligase
Pound upside down on the bench to mix
Give it a quick spin to send it back to the bottom of the tube
Incubate on the benchtop for 30min
Put on ice and proceed to the transformation
  1. Thaw a 200 uL aliquot of cells on ice
  2. Add 50 uL of water to the cells
  3. Add 30 uL of KCM to the cells 
  4. Put your ligation mixture on ice, let cool a minute or two
  5. Add 70 uL of the cell cocktail to the ligation, stir to mix
  6. Let sit on ice for 10 min
  7. Heat shock for 90 seconds at 42 (longer incubation may work better)
  8. Put back on ice for 1 min
  9. Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour
 10. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight

3/8/10

sbb01

  • Prepared a ligation reaction with the Eco/Bam digest of my sbb01 part and pBjk2741 as the vector.

Ligation Protocol

  • proceeded to transformation after the ligation (post-30min RT incubation) was left in ice for awhile while i finished the miniprep for sbb05

Transformation Protocol

  • GSI's plated my transformants as the recovery

sbb05

MINIPREP (1mL - 5mL) Procedure for Plasmid DNA Purification (using the QIAGEN QIAPrep Spin Miniprep kit)

   1. Pellet around 1.5 mL or 2 mL saturated culture by spinning full speed, 30 seconds.
   2. Dump supernatant, repeat to pellet another 1.5 mL (for a total of 3 mL)
   3. Add 250uL of P1 buffer into each tube. Resuspend the cells using a vortexer.
   4. Add 250uL of P2 buffer (a base that denatures everything and causes cells to lyse). Gently mix up and down. Solution should become clearer.
   5. Add 350uL of N3 buffer (an acid of pH ~5 that causes cell junk - including protein and chromosomal DNA - to precipitate, and leaves plasmids and other small molecules in solution). Slowly invert a few times, then shake.
   6. Spin in centrifuge at top speed for 5 minutes.
   7. Label blue columns with an alcohol-resistant lab pen.
   8. Pour liquid into columns, and place the columns into the centrifuge. Spin at 12000 rpm for 30 seconds.
   9. Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin)
  10. Wash each column with 500 uL of PB buffer.
  11. Spin in centrifuge at 12000rpm for approximately 15 seconds, then flick out the liquid again.
  12. Wash with 750uL of PE buffer (washes the salts off the resins).
  13. Spin in centrifuge at 12000rpm for approximately 15 seconds and flick out liquid again.
  14. Spin in centrifuge at full speed for 1 minute to dry off all water and ethanol.
  15. Label new tubes and put columns in them.
  16. Elute them by squirting 50uL of water down the middle of the column (don't let it stick to the sides).
  17. Spin in centrifuge at top speed for 30 seconds.
  18. Take out columns and cap the tubes.
  19. Clean up - note the P1 buffer is stored at 4degC and all the rest at room temperature. 
  • Stored eluted product in tubes labeled 1-4

3/10/10

sbb01

  • NOTE: the LB used to rescue last time turned out to be contaminated, plates have small white spots that may be fungi
  • Mini-prepped the colonies that the GSI's picked as per Miniprep Protocol.
  • saved in tubes for digestion and mapping next time

sbb05

  4uL ddH2O
  4uL Miniprepped plasmid
  1uL 10x NEB Buffer 2
  0.5uL EcoRI
  0.5uL BamHI (for parts >250bp) or XhoI (for parts <250bp)
  Incubate at 37°C for 30min
  • added 1uL of 6x loading dye and ran analytical gel
  • had to re-stain the gel, but bands showed up around 344bp which is good.

Image:BB_3.10.10.jpg

  • my lanes are the rightmost 4, had to take a picture without the plate underneath to see the bands
  • submitted all 4 clones for sequencing

3/15/10

sbb01

Image:BB_03_15_10.jpg

  • my lanes are the rightmost 4, band around 2000 doesn't exactly show that my part is there, but since there is a line at 2000 and not 4000 it shows that the plasmid was double digested so my part should be in there, will send to sequencing.

sbb05

  • recieved sequencing results:
rev-comp s-w opt: 1565  Z-score: 2302.4  bits: 436.2 E(): 2e-126
Smith-Waterman score: 1565;  100.000% identity (100.000% ungapped) in 313 nt overlap (883-1195:1-313)

            860       870       880       890       900       910  
Seq1-  TAAGGATCTGAAGTGGAATTCATGAGATCTTTAACCCTAGAAAGATAGTCTGCGTAAAAT
                                     ::::::::::::::::::::::::::::::
Seq2                                 TTAACCCTAGAAAGATAGTCTGCGTAAAAT
                                             10        20        30

            920       930       940       950       960       970  
Seq1-  TGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGT
       ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
Seq2   TGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGT
               40        50        60        70        80        90

            980       990      1000      1010      1020      1030  
Seq1-  GCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGT
       ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
Seq2   GCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGT
              100       110       120       130       140       150

           1040      1050      1060      1070      1080      1090  
Seq1-  AAGTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGATTATCTT
       ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
Seq2   AAGTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGATTATCTT
              160       170       180       190       200       210

           1100      1110      1120      1130      1140      1150  
Seq1-  TTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTTATTTCATGTTCTACTT
       ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
Seq2   TTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTTATTTCATGTTCTACTT
              220       230       240       250       260       270

           1160      1170      1180      1190      1200      1210  
Seq1-  ACGTGATAACTTATTATATATATATTTTCTTGTTATAGATATCGGATCCTAACTCGCTCC
       :::::::::::::::::::::::::::::::::::::::::::                 
Seq2   ACGTGATAACTTATTATATATATATTTTCTTGTTATAGATATC                 
              280       290       300       310                    

           1220      1230      1240      1250      1260    
Seq1-  TCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCTTCGGCGGGGCTGCC
  • 100% alignment, sequence was seq1 and target was seq2, it worked!
Personal tools