SBB10AssayTeam4-Notes

Carolyn Kwok, Jing Luo, Dorothy Tulanont

Goals

1. Determine whether the N15 protelomerase parts are functional or not on the Tos site assuming the co-transformation is stable.
2a. If the plasmids don't stably co-transform, determine whether cells containing N15 protelomerase enrich for plasmids lacking tos.
2b. Assuming the N15 protelomerase parts are functional, determine whether the linearized "doggy bone" re-circularized in the absence of N15 protelomerase.

General Procedure

Part 1
Experiment:
1. Cotransform cells with plasmid containing the tos site and N15 protelomerase expressing plasmid.
2. Heat-shock
3. Plate with resistance plate
4. Miniprep cells
5. Digest the resulting plasmid with a restriction enzyme.
6. Analytical Mapping
Controls:
1. Transform the cells with only the Tos site plasmid
2. Run the undigested cotransformed DNA.

Part 2a
Experiment:
1. Transform cells with N15 plasmids
2. Plate on antibiotic for N15
3. Pick colonies
4. Mix Tos plasmid and RFP plasmid at a 100:1 ratio
5. Transform mixture into cells
6. Plate on antibiotics for Tos, RFP, and N15 (plate 1)
7. Count ratio of white colonies to red colonies
Control:
1. Mix Tos plasmid and RFP plasmid at a 100:1 ration, transform into cells without N15 and plate (plate 2)
Calculation:
Enrichment = % of red in plate 1/% of red in plate 2

Part 2b
1. Prepare "doggy bone" plasmid and the non-linearized plasmid.
2. Transform "doggy bone" plasmid and the non-linearized plasmid into cells with N15 and cells without N15 (the wild type cells).
3. Count colonies on all 4 plates.

4/12/10

Oligos to fix the point deletion in the tos plasmid using quikchange:

Forward oligo: CAATATGTATCTATTCCGGTGTTGTGTTCCTTTGTTATTCTGC
Reverse oligo: GCAGAATAACAAAGGAACACAACACCGGAATAGATACATATTG

The oligos were diluted to 100uM. Then a quikchange procedure was performed on the tos plasmid according to the Stratagene manual. The following sample reaction was prepared:

 
5 μl of 10× reaction buffer 
2 μl plasmid 
1.25 μl forward oligo
1.25 μl reverse oligo
1 μl of dNTP mix
39.5 μl ddH2O
1 ul PfuTurbo DNA Polymerase

The sample reaction was placed in the thermocycler with the following conditions:

Segment     Cycles      Temperature        Time
1              1           95°C          30seconds
2              12          95°C          30 seconds
                           55°C          1 minute
                           68°C          3 minute (1 min/kb of plasmid length)

4/14/10

The tos quikchange products were transformed into DH10B cells and plated on Amp plates.
The following protocol was used for transformation:
Transformation by Heat Shock
Note No rescue was performed for the transformation mixture because the tos plasmid has Amp resistance.

4/15/10

No quikchange tos plasmid colonies grew.

4/19/10

Notes from last experiment: Our bacteria failed to grow. We have to change the Quikchange protocol.
Dorothy: Digest the vector with pBad and N15 plasmid with BglII and XbaI. Next time --> gel purification of these parts and we can proceed on to ligation.

Digestion of vector (pWCD 0011)
3 uL of water
1 uL NEB2+ATP buffer
5 uL of vector
0.5uL of  BglII
0.5uL of XbaI

Digestion of insert (N15) 
3 uL of water
1 uL of NEB2+ATP buffer
5 uL of insert
0.5uL of  BglII
0.5uL of XbaI

Jing: Starts the Quikchange (running it in the PCR machine). Control will be transforming bacteria without DpnI digestion.

The oligos are lost. Dorothy will come into the lab to start the PCR for quikchange on Tu 4/20 around 6PM.

4/20/10

Dorothy finished quikchange successfully.

4/21/10

We gel purified tos. For N15 (sbb01), we ligate, transform and plate.

4/22/10

Dorothy picked three tos colonies and cultured them.

4/23/10

Carolyn miniprepped the three tos bacteria. Dorothy and Jing ran an analytical gel of tos. We sent the first clone to sequence for verification that the incorrect nucleotide has changed.

4/26/10

Transformed cells

4/27/10

No growth on Kan/Spec plate. Re-picked smaller colonies

4/28/10

No growth