SBB09 Oligos
From OpenWetWare
Put your oligo sequences into this page. Separate each column with tabs:
ca998 Forward Sequencing of pSB1A2/pSB1A3 gtatcacgaggcagaatttcag G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc
Ost001F Forward oligo for upaG ccaaaGAATTCatgAGATCTgttgagatggataacaaactg Ost002R Reverse oligo for upaG ctagcGGATCCttaCCACtgaataccggcaccgag Ost003F Forward construction for HydroxyapatiteBP ccaaaGAATTCatgAGATCTgcgccgtggcatctgagcagccagtatag Ost004R Reverse construction for HydroxyapatiteBP ctagcGGATCCggtgcggctatactggctgctcagatgc
Oso001 Cloning of Autotransporter ccataGAATTCatgAGATCTggctggcaggtcgtcaag Oso002 Cloning of Autotransporter GCTAGggatccTCAatcagctttaccctccac Oso003 Cloning of PL2_Passenger_AT to Autotransporter ccataGAATTCatgAGATCTtgccggcggcgaccagactgtac Oso004 Cloning of PL2_Passenger_AT to Autotransporter gctagGGATCCatcagctttaccctccac
Ojb001F Forward construction of CPG_L2 N term part ctctgGAATTCatgAGATCTgaggaaaggaacgactgg Ojb001R Reverse construction of CPG_L2 N term part catgtGGATCCttacgcgctataatctaccggcc Ojb002F Forward construction of CPG_L2 C term part ctctgGAATTCatgAGATCTggtaaacgtggaacgtggtt Ojb003F Forward removal of XhoI site in CPG_L2 actattatctTgagcgcggc Ojb003R Reverse removal of XhoI site in CPG_L2 gccgcgctcAagataatagt Ojb002R Reverse construction of CPG_L2 C term part catgtGGATCCgaacgagtaatttacgccga Ojb004F Forward SOEing oligo for CPG_L2 GGATCTAAGTCTCGTCGCgaggaaaggaacgactggca Ojb004R Reverse SOEing oligo for CPG_L2 GCGACGAGACTTAGATCCgaacgagtaatttacgccga Ojb005F Forward construction of CPG_L6 N term part ctctgGAATTCatgAGATCTgaggaaaggaacgactgg Ojb005R Reverse construction of CPG_L6 N term part catgtGGATCCttactgccagtcccagttactcc Ojb006F Forward construction of CPG_L2 C term part ctctgGAATTCatgAGATCTgatgatattgaacgtgaagg Ojb006R Reverse construction of CPG_L2 C term part catgtGGATCCgaacgagtaatttacgccga
Bhs001F Forward EcoRI for a~eaeA_Display> cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG Bhs002F Removing the EcoRI site from eaeA_Display GTTAATCAGAAcTCATTTGCAAATG Bhs002R Removing the EcoRI site from eaeA_Display CATTTGCAAATGAgTTCTGATTAAC Bhs003R Reverse BamHI for a~eaeA_Display> GCAAAggatccGCCTTGGTTTGATCAA
Osn0001-F Forward Bglbricking of espP of Escherichia coli O157:H7 str. Sakai ccagtGAATTCatgAGATCTgccccgtcagcatctgccac Osn0002-R Reverse Bglbricking of espP of Escherichia coli O157:H7 str. Sakai gcagtGGATCCtcagaacgagtaacggaaattag
Bdd001F Forward EcoRI oligo for Tsh Autotransporter ccataGAATTCatgAGATCTacacttttacctgtatacg Bdd002R Reverse BamHI oligo for Tsh Autotransporter ctgatGGATCCtcagaatgaataacgaatattagcg Bdd003F Forword oligo for Ice Nucleation Protein ccaaaGAATTCatgAGATCTtgtaATGaatctcgacaaggcg BBa_G00101 Reverse sequencing of pSB1A* plasmids (for INP) attaccgcctttgagtgagc