SBB09 Oligos

From OpenWetWare

Revision as of 12:56, 6 February 2009 by Sadao Ota (talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Jump to navigation Jump to search

Put your oligo sequences into this page. Separate each column with tabs:

ca998	Forward Sequencing of pSB1A2/pSB1A3	gtatcacgaggcagaatttcag
G00101	Reverse sequencing of pSB1A* plasmids	attaccgcctttgagtgagc

Ost001F	Forward oligo for upaG	ccaaaGAATTCatgAGATCTgttgagatggataacaaactg
Ost002R	Reverse oligo for upaG	ctagcGGATCCttaCCACtgaataccggcaccgag
Ost003F	Forward construction for HydroxyapatiteBP	ccaaaGAATTCatgAGATCTgcgccgtggcatctgagcagccagtatag
Ost004R	Reverse construction for HydroxyapatiteBP	ctagcGGATCCggtgcggctatactggctgctcagatgc

Bso001 Cloning of Autotransporter  ccataGAATTCatgAGATCTggctggcaggtcgtcaag
Bso002 Cloning of Autotransporter  GCTAGggatccTCAatcagctttaccctccac
Bso003 Cloning of PL2_Passenger_AT to Autotransporter  ccataGAATTCatgAGATCTtgccggcggcgaccagactgtac
Bso004 Cloning of PL2_Passenger_AT to Autotransporter  gctagGGATCCatcagctttaccctccac

Retrieved from "https://openwetware.org/mediawiki/index.php?title=SBB09_Oligos&oldid=283606"

Navigation menu