SBB09 Oligos
From OpenWetWare
Put your oligo sequences into this page. Separate each column with tabs:
ca998 Forward Sequencing of pSB1A2/pSB1A3 gtatcacgaggcagaatttcag G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc
- This page was last edited on 18 January 2009, at 19:38.
- Content is available under GNU FDL or Creative Commons BY-SA unless otherwise noted.
- -
- About OpenWetWare
- Disclaimers