SBB09 Oligos

From OpenWetWare
Revision as of 19:37, 18 January 2009 by JCAnderson (talk | contribs) (New page: <pre> ca998 Forward Sequencing of pSB1A2/pSB1A3 gtatcacgaggcagaatttcag G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search
ca998	Forward Sequencing of pSB1A2/pSB1A3	gtatcacgaggcagaatttcag
G00101	Reverse sequencing of pSB1A* plasmids	attaccgcctttgagtgagc