SBB09Ntbk-VaiUmesh
From OpenWetWare
~~!~~
Notes
JCAnderson 13:51, 2 February 2009 (EST)
Today I learned how to change a wiki page and made my pages.
Vaibhavi Umesh 2 February 2009 (EST):
- Recieved project ball --> OmpX - Learned how to change a wiki page - Made/edited personal page Things to do - Make wiki notebook page - Make personal page - Read about circularly permuted plasmids - Read paper about OmpX - Begin working on construction file to design OmpX basic part
*Vaibhavi Umesh 4 February 2009 (EST):
- Everyone in class got Project Balls <br> - Worked on Construction files for OmpX
Vaibhavi Umesh 6 February 2009 (EST):
- Worked on designing oligos and the construction file for the project parts
Vaibhavi Umesh 9 February 2009 (EST):
- Worked on designing oligos and the construction file for the project parts - This is what I designed based on reading the paper Chris had suggested:
1) Native N-terminus - OmpX {N.ompX!} PCR VU015F/VU016R on OmpX (529 bp, EcoRI/BamHI) Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, 2057+910, L) Product is M10012 {N.ompX>} ------------------------------------------- VU015F Construction of OmpX N term part ccaaaGAATTCatgAGATCTatgaaaaaaattgcatgtctttcagcactggccgc (40% GC content, length = 55 bp) VU016R Construction of OmpX N term part gcaaaGGATCCttaaccggcaatccaggtgcctacg (56% GC content, length = 36 bp) --------- 2) Native C-terminus - OmpX { AGATCTgttggttaccgcttctaaGGATCC EIPCR VU017F /VU018R on pBca9145-Bca1144#5 (2090 bp, BglII) Product is M10013 { -------------------------------------------- VU017F EIPCR construction of {C.OmpX>} ccataAGATCTgttggttaccgcttctaaGGATCCtaaCTCGAGctgcag VU018R Reverse BglII oligo for His6 EIPCR CCAATAGATCTcatgaattccagaaatc ------------- Assemble the complete part by SOEing Criteria for Linker between N and C terminus: From the paper, I was able to extract the following information: * The linker should be 6 peptides long * The first peptide should be Glycine * The third and sixth positions were restricted to R/K/S/H/Q/N * The substitution A165V resulted in improved display scaffolds * The substitution G166S resulted in improved display scaffolds * The display enhancing substitutions A165V and G166S are located immediately upstream of the native C-terminus of OmpX * The remaining positions (2 and 4) should be randomized keeping all this in mind I thought the following linker would be best suited: GSKNVS which has a nucleotide sequence of: GGTTCTAAAAATGTTTCT New N junction gttggttaccgcttc New C junction aaaaaaattgcatgtctttc Forward Oligo: Linker.C junction GGTTCTAAAAATGTTTCTaaaaaaattgcatgtctttc Reverse Oligo: N junction.Linker gttggttaccgcttcGGTTCTAAAAATGTTTCT Reverse Complement: AGAAACATTTTTAGAACCgaagcggtaaccaac PCR VU019F /VU016R on M10012 (527 bp, gp A) PCR VU017F/VU020R on M10013 (44 bp, gp B) PCR VU021F /VU016R on gp B + gp A (553 bp, EcoRI/BamHI) Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, 2057+910, L) Product is M10014 { ------------------------- VU019F Forward SOEing oligo for cpOmpX GGTTCTAAAAATGTTTCTaaaaaaattgcatgtctttc VU020R Reverse SOEing oligo for cpOmpX AGAAACATTTTTAGAACCgaagcggtaaccaac VU021F Forward construction of C.OmpX ccataAGATCTgttggttaccgcttcGGTTCTAAAAATGTTTCT Note: VU021F had to be used instead of re-using VU017 because VU017 was used to construct {C.OmpX>} through EIPCR
Vaibhavi Umesh 10 February 2009 (EST):
- Project parts were due --> Contruction files - Oligos will be ordered this week - Chris said he would go through all the construction files and make corrections as necessary.
Vaibhavi Umesh 11 February 2009 (EST):
- Chris corrected the construction files:
1) Native C-terminal portion of ompX {N.ompX} PCR Ovu015/Ovu016 on MG1655 gen. (322bp, EcoRI/BamHI) Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, L) Product is pBca9145-M10012 {N.cpx} ----------------------------------------------------------- Ovu015 Construction of OmpX N term part ctagaGAATTCatgAGATCTGGTCAGTCTggtgactacaacaaaaaccag Ovu016 Construction of OmpX N term part gacaaGGATCCgaagcggtaaccaacagaggcaatccaggtgcctac 2) Native N-terminal portion of ompX {C.ompX} PCR Ovu017/Ovu018 on MG1655 gen. (196bp, EcoRI/BamHI) Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, L) Product is pBca9145-M10013 {C.cpx} ----------------------------------------------------------- Ovu017 Construction of OmpX C term part ctagaGAATTCatgAGATCTgcgacttctactgtaactgg Ovu018 Construction of OmpX C term part gacaaGGATCCttaagagcttgcagtacggcttttctcgg 3) SOEing assembly of eCPX PCR Ovu015/Ovu019 on pBca9145-M10012 (334bp, EcoRI/BamHI = A) PCR Ovu020/Ovu018 on pBca9145-M10013 (194bp, EcoRI/BamHI = B) PCR Ovu015/Ovu018 on A+B (505bp, EcoRI/BamHI) Sub into pBca9145-Bca1144#5 (EcoRI/BamHI, L) Product is pBca9495KC-M10014 {<eCPX!} ----------------------------------------------------------- Ovu019 SOEing of eCPX gtcgcTTTAGACTGTTTAGATCCgaagcggtaaccaacag Ovu020 SOEing of eCPX GGATCTAAACAGTCTAAAgcgacttctactgtaactgg
Vaibhavi Umesh 18 February 2009 (EST):
- Started Project! - Oligos came in - diluted all of them - Set up a PCR reaction
Vaibhavi Umesh 23 February 2009 (EST):
- Ran an analytical gel to make sure pcr worked - Did a zymo clean up on the PCR product to obtain the required fragments - Digested the fragments with EcoRI and BamHI (according to the construction file) - Cleaned up the digest * Did not have time to finish ligating and transforming. So, Digests were stored in the freezer until the next lab period
Vaibhavi Umesh 25 February 2009 (EST):
- Ligated the digests from the last lab period - Feb 23rd - Transformed them into DH10B cells and put the plates in the incubator
Vaibhavi Umesh 27 February 2009 (EST):
- Colonies were picked and grown out for us over the weekend - Today: Miniprepping!!! - I had a total of 4 miniprep samples: 2 of each kind (The N and C termini) - After miniprepping, a restriction mapping was performed to see if the samples should even be sent to the sequencing facility. - Restriction mapping: Worked! - Did not have time to send the samples for sequencing today - Will do them on the next lab period
Vaibhavi Umesh 2 March 2009 (EST):
- Samples were sent in for sequencing - However, to avoid wasting time, the 3rd part of the construction file - SOE-ing PCR was started today without verifying that the sequencing of the N and C termini was correct. Only the PCR was set up, such that in the worst case scenario that both the N and C termini constructs were incorrect, I would just discard the SOE-ing PCR tube.