SBB09Ntbk-VaiUmesh

~~!~~

Notes

to do

JCAnderson 13:51, 2 February 2009 (EST)

Today I learned how to change a wiki page and made my pages.

Vaibhavi Umesh 2 February 2009 (EST):

- Recieved project ball --> OmpX
- Learned how to change a wiki page
- Made/edited personal page 

Things to do

- Make wiki notebook page
- Make personal page
- Read about circularly permuted plasmids
- Read paper about OmpX
- Begin working on construction file to design OmpX basic part

*Vaibhavi Umesh 4 February 2009 (EST):

- Everyone in class got Project Balls <br>
- Worked on Construction files for OmpX

Vaibhavi Umesh 6 February 2009 (EST):

- Worked on designing oligos and the construction file for the project parts

Vaibhavi Umesh 9 February 2009 (EST):

- Worked on designing oligos and the construction file for the project parts
- This is what I designed based on reading the paper Chris had suggested:

<pre>
1) Native N-terminus - OmpX                        {N.ompX!}

PCR VU015F/VU016R on OmpX                    (529 bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5                       (EcoRI/BamHI, 2057+910, L)
Product is M10012                                          {N.ompX>}
-------------------------------------------
VU015F  Construction of OmpX N term part
ccaaaGAATTCatgAGATCTatgaaaaaaattgcatgtctttcagcactggccgc    (40% GC content, length = 55 bp)


VU016R  Construction of OmpX  N term part
gcaaaGGATCCttaaccggcaatccaggtgcctacg                                       (56% GC content, length = 36 bp)
---------


2) Native C-terminus - OmpX                                          {
AGATCTgttggttaccgcttctaaGGATCC


EIPCR VU017F /VU018R on pBca9145-Bca1144#5          (2090 bp, BglII)
Product is M10013                                                              { --------------------------------------------
VU017F      EIPCR construction of {C.OmpX>}       ccataAGATCTgttggttaccgcttctaaGGATCCtaaCTCGAGctgcag


VU018R    Reverse BglII oligo for His6 EIPCR   CCAATAGATCTcatgaattccagaaatc
   
-------------


Assemble the complete part by SOEing

Criteria for Linker between N and C terminus:

From the paper, I was able to extract the following information:
* The linker should be 6 peptides long
* The first peptide should be Glycine
* The third and sixth positions were restricted to R/K/S/H/Q/N
* The substitution A165V resulted in improved display scaffolds
* The substitution G166S resulted in improved display scaffolds
* The display enhancing substitutions A165V and G166S are located immediately upstream of the native C-terminus of OmpX
* The remaining positions (2 and 4) should be randomized

keeping all this in mind I thought the following linker would be best suited:
GSKNVS

which has a nucleotide sequence of: GGTTCTAAAAATGTTTCT

New N junction
gttggttaccgcttc

New C junction
aaaaaaattgcatgtctttc

Forward Oligo:

Linker.C junction
GGTTCTAAAAATGTTTCTaaaaaaattgcatgtctttc

Reverse Oligo:

N junction.Linker
gttggttaccgcttcGGTTCTAAAAATGTTTCT

Reverse Complement:
AGAAACATTTTTAGAACCgaagcggtaaccaac
 

PCR VU019F /VU016R on M10012                      (527 bp, gp A)
PCR VU017F/VU020R on M10013                       (44 bp, gp B)
PCR VU021F /VU016R on gp B + gp A                 (553 bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5                              (EcoRI/BamHI, 2057+910, L)
Product is M10014                                                  { -------------------------
VU019F  Forward SOEing oligo for  cpOmpX
GGTTCTAAAAATGTTTCTaaaaaaattgcatgtctttc

VU020R  Reverse SOEing oligo for cpOmpX
AGAAACATTTTTAGAACCgaagcggtaaccaac

VU021F Forward construction of C.OmpX
ccataAGATCTgttggttaccgcttcGGTTCTAAAAATGTTTCT

Note: VU021F had to be used instead of re-using VU017 because VU017 was used to construct {C.OmpX>}  through EIPCR

Vaibhavi Umesh 10 February 2009 (EST):

- Project parts were due --> Contruction files
- Oligos will be ordered this week
- Chris said he would go through all the construction files and make corrections as necessary.

Vaibhavi Umesh 11 February 2009 (EST):

- Chris corrected the construction files:

<pre>

1) Native C-terminal portion of ompX {N.ompX}

PCR Ovu015/Ovu016 on MG1655 gen.          (322bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5               (EcoRI/BamHI, L)
Product is pBca9145-M10012	{N.cpx}
-----------------------------------------------------------
Ovu015	Construction of OmpX N term part	
ctagaGAATTCatgAGATCTGGTCAGTCTggtgactacaacaaaaaccag
Ovu016	Construction of OmpX N term part	
gacaaGGATCCgaagcggtaaccaacagaggcaatccaggtgcctac

2) Native N-terminal portion of ompX {C.ompX}

PCR Ovu017/Ovu018 on MG1655 gen.          (196bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5               (EcoRI/BamHI, L)
Product is pBca9145-M10013	{C.cpx}
-----------------------------------------------------------
Ovu017	Construction of OmpX C term part	
ctagaGAATTCatgAGATCTgcgacttctactgtaactgg
Ovu018	Construction of OmpX C term part	
gacaaGGATCCttaagagcttgcagtacggcttttctcgg	

3) SOEing assembly of eCPX

PCR Ovu015/Ovu019 on pBca9145-M10012        (334bp, EcoRI/BamHI = A)
PCR Ovu020/Ovu018 on pBca9145-M10013        (194bp, EcoRI/BamHI = B)
PCR Ovu015/Ovu018 on A+B                    (505bp, EcoRI/BamHI)
Sub into pBca9145-Bca1144#5               (EcoRI/BamHI, L)
Product is pBca9495KC-M10014	{<eCPX!}
-----------------------------------------------------------
Ovu019	SOEing of eCPX	
gtcgcTTTAGACTGTTTAGATCCgaagcggtaaccaacag
Ovu020	SOEing of eCPX	
GGATCTAAACAGTCTAAAgcgacttctactgtaactgg