SBB09Ntbk-John Wang
From OpenWetWare
Protein A
Flag
Concurrent notes about my project-
My project is to find a engineered protein A. Protein A is an antigen which has been known to bind to IgG. The two papers I choose for designing my part are:
Actual Sequence
How they got to the sequence
The key idea in the papers was that protein A is a protein found in Staphylococcus aureus. The protein is good binding to IgG. There's two sites on IgG that it can bind to. The fab and the fc portions. The fab is of the the 2 heads of the y antibody and the fc (the constant region) is that tail. Since we're only interesting in the tail, an effort was made to find the smallest protein domain possible that still binds to the fc portion of IgG. What I initially didn't understand was why they were expressing conformations of protein A in phages. As it turns out, they were using phages to select for smaller proteins which still bind. Thus they came up with the Z38. However, Z38 turned out to be unstable which lead to the development of Z34C (through further phage display) which actually bind much tighter than Z38 to fc, but loses the ability to bind to fab.
Contents |
5-8-2009
I went in early and started up the 384 well plate. Many of samples in from the colonies from last night did not grow. Furthermore, we were still missing sample 12.
I used 5 CA lb and as well as 5 CA lb with arabanose (I had to do a 1000x dilution) for each sample. I also ran 2 lanes of 20 with just blank CA lb and 20 CA with arabanose lb. Nikil came in by 9 am and we finished just before class started. Nikil came in in the afternoon to start up the Tecan.
5-6-2009
We transformed and plated all of the constructs. We transformed 16 constructs and 2 controls: DH10B and plasmid pBca9495CA-Bca1144. The DH10B was put into a plate with no antibiotics while pBca9495CA-Bca1144 + 16 constructs were put into CA plates.
Doug was unable to come in the following day to pick colonies. Patrick and I picked the colonies.
5-4-2009
We looked at the data Monday and determined that we needed to redo the experiment. We had a lot of bad data, mostly because we did not check to see if there were any colonies that grew from the LB wells.
4-29-2009
We pipetted all of the constructs as well as our controls and ran everything under the Tecan. The pipetting was very tedious to do.
4-27-2009
Today we retransformed controls 21-24 and restreaked the rest of the 12 samples as well as the the 2 controls DH10B and pBca9495CA-Bca1144. The controls are restreaks from Madvi. Doug should come in Tuesday and pick 5 colonies from each (18*5) 90 total and drop each into 400ul of LB.
4-22-2009
Doug came in Tuesday and pciked colonies for us. We are NOT doing the controls since either they aren't important or Madvi is doing them.
- We made 2 tubes of LB. One 850ul tube with 0.85ul of arabanose and one with no added arabanose. We did not need to add antibiotics as it was premixed.
- We added 50ul of LB (no arabanose) to 16 wells
- We added 50ul of LB with arabanose to 16 different wells
- In each of the wells, we added 1ul of the appropriate vector (11-26 or 16 in total)
- We put our sample in the TECAN for 36 time points, 10 minutes between each.
- Doug should come in and take our result for us.
Notes: we had a couple issues. First, the pipette wasn't totally accurate, a couple of us were short on LB from the 850ul tube even though we only needed 800ul. Also, we had some bubbles in the 384 well plate that, when they surface, splashed on the cover. Lastly, after inspection, looking at the side of the 384 well plate, we noticed that the levels of the fluid were not even at all. Some slots seemed to only have 1/2 of what they should be. Thank god this is the test run. I think for the actual run, we are going to take LESS rotations. Rotating between too many people for pipetting doesn't seem to help the accuracy of the measurement.
4-20-2009
We started our assays. We used 2 tubes of 280ul cells and added 10ul water and 60ul KCM to each. We used the 16 constructs and 2 controls DH10B and pBca9495CA-Bca1144. We didn't use pBca9145-Bca9494 (ampicilllin only) since that is only useful for the strepavidin tag. The DH10B control needed to be on a no antibiotic plate and the pBca9495CA-Bca1144 could be plated in the normal CA plate.
3-25-2009
Major renovations to Design Page
3-15-2009
I am opening up an design page with project progress -> Design Page
3-13-2009
I updated my sequence log as well as my progress. My sequences came back ALL PERFECT! HELL YEAH!
Well 67
TTCAACATGCAGTGCCAGCGTCGTTTCTACGAAGCTCTGCACGACCCGAACCTGAACGAAGAACAGCGTAACGCTAAAATCAAATCTATCCGTGACGACTGC
Well 68
GACTACAAGGATGACGACGACAAG
Note: 68 does match the amino acid sequence DYKDDDDK after translation
68 corresponds to the paper pubmed id: 12536251
3-09-2009
Prelab
Just doing a little preparation this time. I'm going to run:
1 mini prep + gel on my protein A.
1 gel for my gateway.
I'm going to start with the gel so I can run it with Sam. Then I'm going to mini prep. I don't need P10s for mini prep so I should be fine with the equipment.
Gel Instructions:
Analytical digests (Mapping)
Set up the following 10uL reaction in a PCR tube:
6.5 uL ddH2O 2uL Miniprepped plasmid 1uL 10x NEB Buffer 2 0.5uL EcoRI 0.5uL BamHI (for parts >250bp) or XhoI (for parts <250bp)
Incubate at 37 on the thermocycler for 30 minutes Run an analytical gel Take a picture of the gel Calculate the expected fragment sizes Are the calculated sizes consistent with the bands on the gel?
Protips
-use 5microliters of ladder
-1ul of 6x corresponds to 6ul. 1ul of 10x corresponds to 10ul
-spin your your tube after using the loading dye.
Alright so finished my mini prep before class and I ran my gel with my protein a and gateway at the same time. My lanes were:
1. gateway 1
2. gateway 2
3. protein a 1
4. protein a 2
All of the bands came up as 1kb. This is VERY GOOD. This is because the part (less that 250 base pairs) + the 1k back bone adds up to around 1k base pairs.
Also, I totally sequenced my stuff. I updated the sequence list, wrote the stuff on the board and gave my stuff to Chris.
If my stuff sequences properly (prays to god) then I'm set.
3-06-2009
I got my culture back from my second try at the protein A BglBrick part. Unfortunately, there was a mix up and my tray was never put into the incubator. Gab says it's fine though so it's going into the incubator now. Also, I ran my miniprep for my gateway reaction. I ran it with a group since we had to share the spinner. I analyzed my gels from my failed first attempt at the protein A. According to my predicted results, I should have 2 bands. In both of the gels, I got 1 band. Gab says to hold off sequencing my first tries until I finish my second try's gels.
I showed my crazy reach over recombinase project to Chris. As it turns out there isn't such a thing as a reach over recombinase. DOH!
3-04-2009
TODAY WAS EXHAUSTING.
So first, I noticed that I had 2 tubes both labels JWI from my initial experiment. I was doing the first part of the experiment sequencially and I forgot to throw out a tube. From now on, I am not only labeling the experiment number and my initials but the step that it is at.
To rectify this, I ran 2 gels and based on the size, I'll determine which tube has my product. I used a XhoI instead of BamhI since I have a wobble.
I took a picture of the finished gel and uploaded it via flash drive to the gel pics page. I labeled with one's which. My order went ladder, a, then b. I'll try and see if I can interpret the ladder and confirm with a GSI tomorrow before I send the correct tube into the sequencer.
Next, I transformed my start over experiment (JWIII). I ligated and transformed.
While that was happening, I also ran my gateway for my flag part. A lot of us weren't sure if we were doing it as a group after we put them inside the incubator or we were individually doing it so it took extra time. I had to stay after a little bit. SORRY GSIs!
To do: Lastly, I need to rearticulate my project idea and present it to Chris tomorrow. Also, I need to reread that article and completely confirm that there is such a thing as a downstream dna recombinase.
3-02-2009
Today I ran my start over sample through zymo clean up- digestion- zymo clean up.
I also mapped my original sample (2 microliters). I gel came up crappy, so I may need to run another gel later. I used 10 microliters of ladder. Gab suggested that I use half that amount next time.
I updated my protocol to include the analytical gel step as well as ligation. Furthermore, I now understand why I CAN run an analytical gel on a wobble now. I digested with Ecori and XhoI instead of BamhI. The reason is to include the antibiotic resistance with my part. This way I can actually get a ready on my gel. My fragment size should include my wobble as well as the antibiotic resistance. In my case it would be A and K. (Amp and KanR)
2-27-2009
Today I did my mini prep. The TAs already picked the colonies and incubated. All we need to do is mini prep the vials.
Since I only had 1 colony on my plate, I was advised by Chris to start over. I started over and finished up to the PCR step.
Also, I started over a fresh experiment in case I didn't do it right the first time. My plate was "suspicious" because there was only 1 colony. The dntps were of the wrong concentration the first time I started over so I did it over again with Gab making a fresh dntp set with the right concentration (2 mmol instead of 10 mmol).
2-24-2009
Today I ligated and transformed my stuff. I wondered about why I was putting my ligation on ice for the transformation part. I asked Tim who explained that the idea is that I ice it then warm it and that heat shock will create pores on the bacteria which will allow for the DNA to go in. We're waiting 10 minutes because we want to give the dna time to go in. Also, I just wanted to note a tip when spreading onto the plate, if it sizzles, you know it's too hot.
2-23-2009
I ran both of my reaction through small frag zymo clean up, digest, and another small frag zymo cleanup. My first batch was successful. On my second batch there was an unfortunately side affect when my lab partner accidentally grabbed the PB buffer instead of the PE buffer. I decided to scrap my second experiment since it was corrupted at that step anyways. In the end I had a 50 nM (probably less if I lost product along the way) product.
2-18-2009
I did my reaction. A piece of a wool sweater fell into my initial reaction so I had to redo it. My initial concentrations were 60.2nm and 55.5nm and so I had to dilute to 602ul of water and 555ul of water respectively. I had extra time and I ended up doing the experiment twice. I kept the second sample as a safety in case my first one was corrupted. I ran my experimental protocol up until the PCR step.
2-16-2009
So I did a bit of cleaning on my wiki page and created: http://openwetware.org/wiki/Protein_A_FLAG_Tag_M10018_M10019
I suppose I am going to finish my zymo clean-up. Not sure if I'll be able to start digestion unless I have an hour and 30 left. If I can just finish digestion, that would make my life a lot easier next time.
Also I'm adding a link to the gateway reaction for my second part just for my own convenience: Flag
2-6-2009
Today I made my openwetware notebook page.


