SBB09Ntbk-Hank Shih
02/09/2009
Finished making basic part for M10024. This is the final construction file:
Construction of {a~eaeA_Display>} basic part PCR Bhs001F/Bhs002R on E. coli strain 0157:H7 (146 bp, gp = A) PCR Bhs002F/Bhs003R on E. coli strain 0157:H7 (1889 bp, gp = B) ---------------------------- PCR Bhs001F/Bhs003R on A+B (2009 bp, EcoRI/BamHI) Digest pBca9495CA-Bca1144#5 (EcoRI/BamHI, 3039+910, L) Product is pBca9495CA-M10024 {a~eaeA_Display>} ---------------------------- Bhs001F Forward EcoRI for a~eaeA_Display> cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG Bhs002F Removing the EcoRI site from eaeA_Display GTTAATCAGAACTCATTTGCAAATGG Bhs002R Removing the EcoRI site from eaeA_Display CCATTTGCAAATGAGTTCTGATTAAC Bhs003R Reverse BamHI for a~eaeA_Display> GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC
02/18/2009
Today, I've setup my first two PCR reactions with Bhs001F/Bhs002R and Bhs002F/Bhs003R. The standard protocol was followed. The mixture was composed of the following:
24uL ddH2O 3.3uL 10x Expand Buffer "2" 3.3uL dNTPs (2mM in each) 1uL Oligo 1, 10uM 1uL Oligo 2, 10uM 0.5uL Expand polymerase "1" 0.5uL Template DNA
The Bhs001F/Bhs002R PCR had an expected product of 146bp and was ran on the 55 program. The Bhs002F/Bhs003R PCR had an expected product of 1889bp and was ran on the 2K55 program.
02/23/2009
Today, I got both PCR products back. In order to proceed to the next step, I need to gel purify my PCR products. This was also a great time to see if the PCR products came out as expected.
To setup my gel, I've mixed 5uL of PCR product with 5 uL of loading buffer. This was a change from protocol because the loading buffer looked quite diluted. This mixture was loaded into the 1% agarose gel. The following picture is the results: