SBB09Ntbk-Hank Shih
From OpenWetWare
02/09/2009
Finished making basic part for M10024. This is the final construction file:
Construction of {a~eaeA_Display>} basic part PCR Bhs001F/Bhs002R on E. coli strain 0157:H7 (146 bp, gp = A) PCR Bhs002F/Bhs003R on E. coli strain 0157:H7 (1889 bp, gp = B) ---------------------------- PCR Bhs001F/Bhs003R on A+B (2009 bp, EcoRI/BamHI) Digest pBca9495CA-Bca1144#5 (EcoRI/BamHI, 3039+910, L) Product is pBca9495CA-M10024 {a~eaeA_Display>} ---------------------------- Bhs001F Forward EcoRI for a~eaeA_Display> cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG Bhs002F Removing the EcoRI site from eaeA_Display GTTAATCAGAACTCATTTGCAAATGG Bhs002R Removing the EcoRI site from eaeA_Display CCATTTGCAAATGAGTTCTGATTAAC Bhs003R Reverse BamHI for a~eaeA_Display> GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC
02/18/2009
Today, I've setup my first two PCR reactions with Bhs001F/Bhs002R and Bhs002F/Bhs003R.